Answered: Correct! The Leu codon is changed to a…

Name: Correct! The Leu codon is changed to a nonsense codon by a single-base
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: Correct! The Leu codon is changed to a nonsense codon by a single-base substitution How many different ways can the LEU codon be changed into the nonsense mutation? 362110

Science

Biology

Correct! The Leu codon is changed to a nonsense codon by a single-base substitution How many different ways can the LEU codon be changed into the nonsense mutation? 362110

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter30: Protein Synthesis

Section: Chapter Questions

Problem 6P

See similar textbooks

Similar questions

PLEASE ANSWER WHY? Some substitution mutation result in a malfunctioning protein but others do not. Why is this?
5’-CCTAGACCATAACAT-3’ What happens to the amino acid sequence above as a result of each of the following mutations in the DNA: Substitution of A with T at position 4? Addition of T between positions 8 and 9? Substitution of A with T at position 11? Deletion of A at position 12? Substitution of C with T at position 7? State the type of mutation for each of the base changes indicated.
100All tRNA molecules have poly (A) tails at their 3' end. Yesorno
Good afternoon, Guidance with this question would be most appriciated. Thank you for your time. Polypeptide sequences are formed from 20 amino acids. What is the probability that a single point mutation in a gene will result in a different polypeptide sequence?
From this DNA sequence DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’, change one base in codon 8 to show same sense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:Identify the type of base pair substitution that you applied in codon 8
Frameshift mutation _____________________ Select one: can result in a completely new codon sequence that results in the production of non-functional proteins. applies to the reading frame (sequence of codons) being changed. All of the choices are correct. most of the happen when one or more nucleotides are inserted or deleted from the DNA.
Need help:. Researchers add poly-(CGU) to an in vitro TL system. What poly-amino acids are produced? How would the researchers determine which codon encoded each of these amino acids? 5’CGUCGUCGUCGUCGUCGUCGUCGU...3’
Met-enkephalin (Tyr–Gly–Gly–Phe–Met) is a painkiller and sedative (Section 21.5). What is a possible nucleotide sequence in the template strand of the gene that codes for met-enkephalin, assuming that every base of the gene is transcribed and then translated?
Make me frameshift mutation
Hello, I would really appiarte help appreciate help. This is a blank question so I am unsure why it was rejected immeditely the first time. Thank you in advance. Identify the type of mutation and how it would affect the protein made (amino acid) if the following changes occurred in the DNA antisense strand First codon change from TAC to TAT. Third codon change from ACG to ACA. Ninth nucleotide changes from G to T. Nucleotide with adenine (A) base inserted between 3rd and 4th nucleotide. Types of Mutation Changes in the Amino Acid 1. 2. 3. 4.
Multiple choice A. The role of tRNA in translation is to be translated by a ribosome. incorporate into a polypeptide chain. attach amino acids to a polypeptide chain. carry amino acids to the ribosome. Multiple choice B. Translation continues until the ribosome falls off the end of the RNA. the ribosome encounters a transcriptional termination site. the ribosome encounters a stop codon. the ribosome falls off the DNA.
From this DNA sequence DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’, change the third base in codon 4 to show missensemutation. Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:Identify the type of base pair substitution that you applied in codon 4