Answered: Make me frameshift mutation

Name: Make me frameshift mutation
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: Make me frameshift mutation

Science

Biology

Make me frameshift mutation

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 9SQ

See similar textbooks

Related questions

Q: GAT C |||||||| ||||| | || | | || | || | || a.) What is the base sequence of the sample ssDNA? b.) If…

A: NUCLEOTIDE SEQUENCING: The process of determining the order of nucleotides in a genome is known as…

Q: the savannahs of the Amazon different species of the genus Ipomoea are pollinated by either…

A: Postzygotic isolation occurs when the mating between the members of two different species produces a…

Q: The inhibition of bacterial growth and reproduction without necessarily destroying the organisms is…

A: The growth and reproduction of bacteria depends on saveral factors. For the inhibition of the growth…

Q: Did the investigator collect adequate information to determine the source of the outbreak? Provide a…

A: Introduction Disease outbreak investigation involves steps to identify the cause of a disease…

Q: What is the melting temperature and G/C content of the following primers? a.) 5’…

A: A primer is a short single strand of DNA that serves as a starting point for DNA synthesis of a new…

Q: Fever can indicate that a. the pathogen remains on the skin D. the body is responding to an…

A: Normal temperature of the body is 98.6 degree fahrenheit. Fever occurs when this temperature rises.

Q: unknown coding strand of the DNA can be easily determined. G A T с ||_ |||||| | || <|||| | |_|| | ||…

A: Introduction There are two types of nucleic acids are present in our body, DNA and RNA. DNA acts as…

Q: The increase use of fossil fuels increases the Select one: O a. rate of photosynthesis of marine and…

A: Fossil fuels are the reserved fuels buried in the deep earth crust. The supply of fossil fuels is…

Q: Describe the importance of fungi in biology and medicine and the way in which fungi infect humans…

A: Introduction Fungus is the eukaryotic organisms that belong to the Kingdom of Fungi. These organisms…

Q: What part of the genome is used for a genetic fingerprint? A Introns Ministe OC. Chromosomes OD…

A: DNA fingerprinting is a technique that shows the genetic makeup of living things.

Q: What is an example of an adaptation that plants have that help them survive in different climates?

A: Plants have adaptations to help them survive in different areas or different climatic conditions.

Q: What does actually determines the no of nuclear pores present in a nucleus?

A: The nuclear pore is indeed a protein-lined channel in the nuclear envelope which controls molecule…

Q: The per capita growth rate of the flowering rush population above from 2009 to 2016 was Answer: Show…

A: Introduction The population growth rate is defined as the change in population that occurred per…

Q: 1. There are four groups of plants. Each plant can be EITHER vascular or non-vascular and EITHER…

A: There are four groups of plants. This includes- Moss (Bryophytes) - They are non-vascular and…

Q: 8. Determine the mechanisms that DO NOT contribute to the genetic variations among the offspring. A.…

A: Introduction Cell division is that the technique through that a parent cell divides into a pair of…

Q: What are four key qualities that must be maintained by homeostasis?

A: The concept of homeostasis is the maintenance of equilibrium throughout a living thing's body. It…

Q: . In DNA amplification, using the Taq polymerase, what is the maximum number of amplification…

Q: Question 33 (1 point) ✓ Saved Which of the following reactions is catalyzed by carbonic anhydrase?…

Q: 1. Why are the finds at Malapa remarkable compared to other fossil sites in Africa? dib

A: The branch of biology known as evolutionary biology examines how natural selection, common ancestor,…

Q: Is water acceptable for potable or Recreational use? Explain.

A: Introduction The reason why water is such a good solvent is, Water molecules have 2 hydrogen atoms…

Q: how have microarrays demonstrated that, all cells of an organism have the same genome, some genes…

A: Lab-on-a-chip is another name for microarray. This method is used to simultaneously evaluate the…

Q: Q1. Determine if the event occurs during mitosis or during meiosis. Copy and paste, mitosis or…

A: Synapsis is the pairing of homologous chromosomes prior to their separation into daughter cells. It…

Q: If the above gene is one of the three structural genes of the lac operon that codes for the protein/…

A: The bacterium Ecoli possess a highly effective lactose Metabolism process . The lac operon is a…

Q: Agrobacterium tumefaciens is also known as nature's genetic engineer. Justify this statement.

A: Introduction :- Agrobacterium tumefaciens is a gram-negative bacterium that causes tumours in plants…

Q: Plants store glucose as _____ and _____. starch; sucrose fructose; sucrose galactose; fructose…

A: The complexity of physical and chemical processes involved in photosynthesis, respiration, and the…

Q: on a gene in a microorganism that provides a characteristic you find interesting. However, I want it…

A: Microbes are one of the smartest living entities in this living world. As a part of evolution, they…

Q: Alcohol addiction is a condition in which a person experiences dependent on alcohol and difficult to…

A: Alcohol has been shown to quickly pass membrane barriers, influence the brain, and central nervous…

Q: Q4. Select the missing evaluation given the plant characteristic. Plant Characteristic Underground…

A: Due to their geophilic nature, the stems lack shade of green and are altered to conduct a variety of…

Q: Q3. Photodynamic therapy results in induction of WAF1 or CIP1 or P21 leading to cell cycle arrest…

A: Photodynamic therapy (PDT) is a promising new modality that utilizes a combination of a…

Q: Give a brief pathophysiology of diabetic kito acidosis.Including the signs and symptoms of DKA

A: Diabetic kito acidosis define as complication where the body produces excess blood acids…

Q: Determine the justification for variation in the phenotypic expression of MERRF in identical twins.

A: Myoclonus Epilepsy with Ragged-Red Fibers Syndrome, often known as MERRF, affects the neurological…

Q: Analyze Approximately how much chlorophyll was present in the low-light plants after 24 hours? In…

A: In this experiment, we will be testing the effects of light intensity on the production of…

Q: Linear evolution suggests that there is a ladder, or step- progression, to evolution over time one…

A: The pre-Darwinian theories established by Aristotle, when species were believed to be static…

Q: Which statement is true about transposon? a. Transposon is known as a ‘jumping gene’. b.…

A: The science of genes and inheritance, or how particular characteristics or traits are transferred…

Q: How does a positive ASO test for sickle-cell anemia ?

A: Sickle cell anemia is a disease in which the body produces red blood cells that are shaped like…

Q: Sea otters importance

A: Introduction: Marine animals known as sea otters (Enhydra lutris) live along the coasts of the…

Q: Individuals infected with herpes simplex virus (HSV) mount protective antibody responses directed…

A: 1. The alternative route is activated by Thr hydrolysis of C3 on the cell surface. In opsonization…

Q: Describe the effect of the deletion on co-transformation of pure and pepN genes that are isolated…

A: Transformation is a process of transforming the genes of one strain and then transferring it to…

Q: Bison roamed free in an area along the eastern slopes of the Rockies, in what is now Banff National…

A: Gene frequency:- it is usually represent the percentage of the population that have one type of a…

Q: There is no bird without feathers. A. true B. false

A: Birds: A class of warm-blooded animals known as the Aves, birds are distinguished by their feathers,…

Q: Does A. sediba support the "killer ape" hypothesis of human ancestry? Explain.

A: An ancient species of australopithecine was discovered in Malapa Cave, the Birthplace of Humankind,…

Q: Explain the principles of the redox code. Distinguish between redox switches and redox sensors.

A: Biological systems follow a redox code that defines how nicotinamide adenine dinucleotide (NAD,…

Q: Describe the chain of events that connect the release of CFCs from discarded refrigerators to…

A: Introduction : CFC's are the Chlorofluorocarbons.They are the chemical substances that are held…

Q: Illness and infections typically cause:

A: Illness is any unhealthy condition which alters the normal body health. It could be acute or chronic…

Q: Mosses are small plants that produce spores and need a damp place to live. A. True B. False…

A: Introduction :- Certain fungi, plants (moss, ferns), and bacteria create spores, which are cells.…

Q: Briefly describe how toe Bradford protein assay works

A: Introduction There are several methods to determine various biomolecules either quantitatively or…

Q: Describe the four processes of toxicokinetics. A) absorption B) distribution C)…

A: Introduction In essence, toxicokinetics is the study of how a chemical enters the body and what…

Q: fine the vasomotion? Also What is autoregulation of local blood flow

A: Vasomotion regulates the flow of nutrients and liquids between the circulatory system and peripheral…

Q: I was wondering if taking ap biology is a bad decission as a freshman.

A: The College Board in the United States offers the Advanced Placement (AP) Biology course and exam,…

Q: V. Materials. To be procured by each student: Genetic code VI. Procedure 1. Assume that a segment of…

A: DNA strand "A" = 5' TTCTTGTCATACTGCTGGCTGCCCCACCAGCGAATGGTGACAAACAAG 3' Note:-i answer according to…

Concept explainers

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.

Topic Video

Question

Make me frameshift mutation

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Mutations I used: stop codon, insertion, deletion and substitution. Explanation please.
A point mutation that replaces a purine with another purine, or a pyrimidine with another pyramidinea) Nonsense mutationb) Silent mutationc) Transition mutationd) Transversion
make a point mutation and Frameshift mutation
Frameshift mutation _____________________ Select one: can result in a completely new codon sequence that results in the production of non-functional proteins. applies to the reading frame (sequence of codons) being changed. All of the choices are correct. most of the happen when one or more nucleotides are inserted or deleted from the DNA.
Original: ATTTGAGCC Mutated: ATTGAGCC. This is an example of what kind of mutation? Inversion Insertion-Frameshift Deletion-Frameshift All of them
⦁ Original: ATTTGAGCCMutated: ATTGAGCC. This is an example of what kind of mutation?
Which of the following best describes this type of mutation? Original – CCU-GAU-GAG-UCA Mutated – CCU-GAU-GAG-UGA* Please choose one correct answer only A. Missense B. Nonsense C. Silent D. Frameshift
This is a missense mutation explain. Include the ideas of translation and transcription. Compare the normal and abnormal strands.
From this DNA sequence DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’, change one base in codon 8 to show same sense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:Identify the type of base pair substitution that you applied in codon 8
ATTTGAGCC- OriginalATTGAGCC - Mutated The example above is an example of a Nonsense Deletion- Substitution Insertion- Frameshift Deletion -Frameshift
The original DNA sequence TACACCTTGGCGACT I need the mRNA sequence and the amino acid sequence And also the mutation type
Given the sequence of triplet codons: 5′-TAC AAA ATA CAG CGG-3′, write out one of each: transition; transversion; silent; missense; nonsense; frameshift mutations;