Create a Menu Driven program with the following choices: 1.] Addition of Matrices 2.] Scalar Multiplication 3.] Cramers Rule (3 * 3 Matrix) The following instructions must be evident: looping functions array conditional statements
Q: Debug the following code in C++. This file is used to print integers from highest to lowest,…
A: The debugged code is provided in next step:
Q: Write a simple JavaScript program to calculate the average mark and to calculate the grade of a…
A: script.js // function for calculateAverageMarkfunction calculateAverageMark(...args) { // args is…
Q: Use functional decomposition to write a C++ program that asks the user to enter his or her weight…
A: Objective: This program determines the weight of the user if the type of the planet is given. Planet…
Q: C++ Functions provide a means to modularize applications Write a function called "Calculate" takes…
A: double squareArea(double side) { double lArea; lArea = side * side; return lArea; }
Q: C++ PROBLEM: PASTE INDENTED CODE PLZZ Given the following functions: void increment(int x, int…
A: 1. Explanation: In the main() function, initializing n = 10 and amount = 5 Calling the increment()…
Q: Language: C++ Consider the abs function, which determines the absolute values of a real number. The…
A: #include<iostream> using namespace std; int abs(int a) { if (a<0) return…
Q: 3 using namespace std; 4 Program 6-22 tion arguments. It has a function that displays aster- isks on…
A: While creating the function we can set the arguments of the function with some default value so that…
Q: Write a function named "reduce" that takes two positive integer arguments (as reference), call them…
A: In the solution of the given problem we need to find the highest common factor of numerator and…
Q: please solve this in python //////////////// //////////////// //////////////// ////////////////
A: Program Instructions:Create three functions namely top(), body() and word() to print the different…
Q: Design and write a C program that performs the following functionality
A: Transposition is a concept of a Matrix with rows and columns. You should know that the transposition…
Q: (C PROGRAMMING ONLY!) 6. Teaching the Dog To Sit by CodeChum Admin Ever since I was a kid, I've…
A: Hello student Greetings Hope you are doing great. Thank You!!!
Q: Reads data from an input file. The data file should include 10 students. Each student should have…
A: //headers #include <iostream>#include <fstream>#include <iomanip>#include…
Q: Code in C please. write a user defined function called pasttense that takes one argument a character…
A: logic:- In user defined function, calculate length of passed parameter. then fetch out last two…
Q: Write a C function that has threeparms andreturns void. The first twoparmsare arrays of ints; these…
A: Run a 'for' loop from i=0 to i=size-1, if at any index array2[i]>array1[i] then change array1[i]…
Q: C++ Functions provide a means to modularize applications Write a function called "Calculate" takes…
A: Required:
Q: C++ programming Chapter(s) Covered: Chapter 1-8 Concepts tested by the program: Working with one…
A: Code: #include<iostream>#include <algorithm>using namespace std; // Global…
Q: Topic: Functions Create a functional program that can calculate the displacement and velocity of a…
A: The program is implemented in C programming language with structured approach. In main function we…
Q: Complete C++ source code for Write a complete C++ program to help the manufacturer determine the…
A: Code: #include <iostream> #include <fstream> using namespace std; //fucntion…
Q: Write a function that takes three integer pointer as parameters and calculates sum of all numbers.…
A: The required C++ code: #include<iostream>#include<iomanip>using namespace std;struct…
Q: Python: 3 total functions for the following 1) a function that accepts a string as an argument and…
A: Python Code: def upper(string): s='' for word in string.split(): # split string…
Q: Solve the problem in C++ (Financial application: compute the future investment value) Write a…
A: #include <iostream>#include <math.h>using namespace std; double…
Q: TOPIC: POINTERS 1.Create a C function main() and do the following sequence of instructions: 1.…
A: In the C programming language, a pointer is a variable that holds the location of another variable.…
Q: A function named power has already been defined. It consumes two int arguments and returns the int…
A: Power function is made. Give two integer type input. Return argument 1 raised to power argument 2.…
Q: m with two user defined functions. The first function named “functionWithArray” takes two user input…
A: code : Here is my code for 5.1 : #include <iostream> #include <string.h> using namespace…
Q: Q1: A complex number x=(a + jb) contains two parts, a real part (a) and an imaginary part (b). Write…
A: #include <iostream>// structure for float_cclass float_c{public: // two data members float…
Q: 13: bigNumber.cpp) Write functions for doing arithmetic on 100-digit integers. Include functions for…
A: #include <iostream> using namespace std; // Function prototypes void readBig(int[]); void…
Q: C++ Write a function that accepts an int array and the array’s size as arguments. The function…
A: The solution for the above given program is given below:
Q: TOPICS THAT CAN BE USED: OOP, Pointers and Functions, Arrays and Structs, Repetition Statements,…
A: #include <iostream>#include <math.h> using namespace std; float getTriangleArea(float…
Q: 2. Write a C program to develop a simple calculator. You should have a functions as follow: Function…
A: Given:
Q: Using C++ Assume proper includes have been executed, but not using directive or declaration. Write a…
A: - We are using vectors and iterators in c++.
Q: c++ program The program below misses the function declaration and definition of Sum_Of_Squares…
A: The sum of squares of two numbers has to be stored in result As result is passed by reference, the…
Q: Define the function: int power (int base, int exp) {/*It accepts the arguments for base and exponent…
A: I give the code in C as per your requirement along with output and code screenshot
Q: 5. ANN Consultancy provides various short courses in IT. Below are some of the short courses…
A: Step-1: Start Step-2: Declare variables code=0, persons=0, discount=0, newTotalFees=0, personFees=0,…
Q: Implement the following functions: a. float diameter(Circle circ); //computes the diameter of…
A: C program: C is a general purpose programming language. It was developed by Dennis Ritchie at AT…
Q: C PROGRAM- USING DATA ABSTRACTION Create: the library(header file), source file(definition),…
A: Program Approach:- 1. Create the header file a)First create the header file name b)Create the body…
Q: H. Using Structures and Files: Create a C++ program for Banking record system. Note that: program…
A: C++ is a powerful general-purpose programming language. It can be used to develop operating systems,…
Q: c++ program The program below misses the function declaration and definition of Sum_Of_Squares…
A: Here is the approach : For the function defination . We can see that we have to save the result in…
Q: 2. Safir Market wants you to create a simple python program for calculating Total cost and change…
A: def display(): # user define function…
Q: Numbers that are the same as the direction of reading when they are read backwards and straight are…
A: C Code of to find number is palindrome or not is detailed in step 2 with sample output below.
Q: Q: Write a C program code for matrix multiplica tion (C = AB)with following features: • The program…
A: The condition for checking if two matrices are multiplied or not is checked by the below equation…
Q: Summative Assessment 2: Simple Payroll Computation Program Using Functions Computer Programming…
A: Program #include <iostream> using namespace std; //define computeGP function float…
Q: ineering Computer Engineering Q&A Library Function: Create a function which accepts patient id…
A: Source code: CREATE PACKAGE Package_FinalB ASPROCEDURE Procedure_P(i_patient_id IN number)FUNCTION…
Q: need help in C++ Problem: You are asked to create a program for storing the catalog of movies at a…
A: #include <iostream> using namespace std; // Create a structure to store movie detailsstruct…
Q: Complex numbers Program a new data type for complex numbers. (In C/C++ this can be done using a…
A: Here I written code in C++ for this complex numbers problem. I hope you like it.
Q: Design and write a C program that performs the following functionality: Prompt the user to enter a…
A: the steps to transpose the row to column vector recursively are if the row./column exceeds the size…
Q: Problem Statement A long stretch of beach is represented by a string of two characters: 0 - free, 1…
A: def sun_loungers(string): string = list(string) count = 0 l = len(string) if l >…
Q: Module/Week 7 ASSIGNMENT (ARRAYS)Use functional decomposition to write a C++ program that asks the…
A: This C++ program is used to calculate the user's weight according to the planet. To calculate…
Q: SOLVE IN C PROGRAMMING LANGUAGE Q # 1. Illustrate your knowledge of C-Programming by implementing…
A: a) CODE:- #include<stdio.h> int check_prime(int); main(){ int n, result; printf("Enter an…
Q: ask: IN C PROGRAMING 1. Create a program that accepts five unsorted numbers. These can be…
A:
C++
Create a Menu Driven program with the following choices:
1.] Addition of Matrices
2.] Scalar Multiplication
3.] Cramers Rule (3 * 3 Matrix)
The following instructions must be evident:
- looping
- functions
- array
- conditional statements
Step by step
Solved in 2 steps
- Task - Using pointers to process arrays (C Language) Example #5 below expected output is 45, but from the program below its coming out to 46. Please help make it come out to 45 as expected In a TV show, each minute can be either interesting or boring. Assume that if 7 consecutive minutes are boring, then an average viewer will stop watching the show. Write a C program that calculates how many minutes that an average viewer will watch a TV show, given the interesting minutes. Assume the TV shows are 45 minutes long. Requirements Name your program project4_minutes.c. Follow the format of the examples below. The program will read in the number of interesting minutes, then read in the interesting minutes. The program should include the following function. Do not modify the function prototype. int find_minute(int *minutes, int n); minutes represents the input array for interesting minutes, n is the length of the array (the number of interesting minutes). The function returns the how…Topic: Recursive Function A bank increases the interest rate it gives to its customers by 1% every month the money stays in the bank. Write the recursive function that calculates the total amount of money at the end of the maturity date, based on the condition below. The parameters of the function: capital, initial interest rate and maturity date(months) Note: Codes should be written in C programming language.Create a C++ Grocery Program according to this guideline: Linked List Functions Pointers Arrays The program must have a menu layout where the user can select certain action (Select Product, View My Cart, Check-Out, etc.) Include grocery items (e.g. Fruits, Vegetables, Drinks, etc.) Implement basic error tapping Include the group name of the developers with the name of each developer (a total of 4)
- ✓ Allowed languages C Problem Statement Write a C Program that will compute for the GCD of M numbers Input Input starts with a number N and is followed by N sets of numbers (M, A₁, A₁,...AM). We need to compute for the GCD of A₁, A₂....AM Output The set of N numbers indicating the GCD of each of the inputs Limits 1Create a C++ Grocery Program according to this guideline: Linked List Functions Pointers Arrays The program must have a menu layout where the user can select certain action (Select Product, View My Cart, Check-Out, etc.) You must include all kinds of drinks/beverages Implement basic error tapping IYou must include the group name of the developers with the name of each developer (a total of 4) Group Name: In-Out Group Names: Cesar Rachel Jennifer TomCollatz Sequence Please create a C-program with the use of looping statements and conditional statements. Please do NOT use pointers, please! :) The Collatz conjecture is a conjecture in mathematics named after Lothar Collatz, who first proposed it in 1937. The conjecture is also known as the 3n + 1 conjecture, the Ulam conjecture (after Stanisław Ulam), Kakutani’s problem (after Shizuo Kakutani), the Thwaites conjecture (after Bryan Thwaites), Hasse’s algorithm (after Helmut Hasse), or the Syracuse problem; the sequence of numbers involved is referred to as the hailstone sequence or hailstone numbers (because the values are usually subject to multiple descents and ascents like hailstones in a cloud), or as wondrous numbers. Mathematics The Collatz function is defined for a positive integer n as follows. f(n) = 3n+1 if n is odd n/2 if n is even We consider the repeated application of the Collatz function starting with a given integer n, as follows: f(n),…pointers as Arguments:In the C programming language there is no pass-by-reference syntax to passa variable by reference to a function. Instead a variable is passed by pointer(just to be confusing, sometimes passing by pointer is referred to as pass byreference). This Practice Program asks you to do the same thing as C.Here is the header for a function that takes as input a pointer to an integer:1. void addOne (int ∗ptrNum )Complete the function so it adds one to the integer referenced by ptrNum.Write a main function where an integer variable is defined, give it an initialvalue, call addOne, and output the variable. It should be incremented by 1.Month Day Calculator in C Using basic concepts of Pointers and Structures (Pointers and Multi-dimensional arrays), create a C program that calculates the month's day from a given year and year's day. Use pointers for the month and month's day variables. Don't forget to add proper errors handling in your program. - Follow the instructions below for handling error. - Invalid Input- Invalid year- Invalid year day Modify the provided monthAndDay.c class file to receive the parameters in the way and also print the proper formatted output. Example: # ./month_day <year> <yearday> # Example for Feb 2nd, 2019:\$ ./month-day 2019 33Feb 02, 2019 class- monthAndDay.c - #include <stdio.h> /* monthAndDay function's prototype*/void monthAndDay(int year, int yearday, int *pmonth, int *pday); int main() {return 0;}6. Sum of Numbers Design a function that accepts an integer argument and returns the sum of all the integers from 1 up to the number passed as an argument. For example, if 50 is passed as an argument, the function will return the sum of 1, 2, 3, 4, . . . 50. Use recursion to calculate the sum. solve using PythonC PROGRAM Create a c program that will convert number figures into words 1. You can use user-defined functions, string, array, and loops 2. Maximum input limit is 10000.00 Sample output (bold letters is for input) Enter amount in Peso: 143.50 You just entered P145.50 equivalent to One Hundred Forty Three and Fifty Centavos. Do you want to convert another amount? [Y|N]: NC++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…MULTIPLE FUNCTIONS AND RECURSIVE FUNCTIONS HANDS-ON use #include<stdio.h>SEE MORE QUESTIONS