Computer Networking: A Top-Down Approach (7th Edition)
7th Edition
ISBN: 9780133594140
Author: James Kurose, Keith Ross
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Related questions
Question
thumb_up100%
Collatz Sequence
Please create a C-program with the use of looping statements and conditional statements. Please do NOT use pointers, please! :)
The Collatz conjecture is a conjecture in mathematics named after Lothar Collatz, who first proposed it in 1937. The conjecture is also known as the 3n + 1 conjecture, the Ulam conjecture (after Stanisław Ulam), Kakutani’s problem (after Shizuo Kakutani), the Thwaites conjecture (after Bryan Thwaites), Hasse’s algorithm (after Helmut Hasse), or the Syracuse problem; the sequence of numbers involved is referred to as the hailstone sequence or hailstone numbers (because the values are usually subject to multiple descents and ascents like hailstones in a cloud), or as wondrous numbers.
Mathematics
The Collatz function is defined for a positive integer n as follows.
f(n) = 3n+1 if n is odd
n/2 if n is even
We consider the repeated application of the Collatz function starting with a given integer n, as follows:
f(n), f(f(n)), f(f(f(n))), …
It is conjectured that no matter which positive integer n you start from, this sequence eventually will have 1 in it. It has been verified to hold for numbers up to 5 × 260 [Wikipedia: Collatz Conjecture].
If n=7, the sequence is
f(7) = 22
f(f(7)) = f(22) = 11
f(11) = 34
f(34) = 17
f(17) = 52
f(52) = 26
f(26) = 13
f(13) = 40
f(40) = 20
f(20) = 10
f(10) = 5
f(5) = 16
f(16) = 8
f(8) = 4
f(4) = 2
f(2) = 1
Thus if you start from n=7, you need to apply f 16 times in order to first get 1.
In this question, you will be given a positive number
Expert Solution
This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
This is a popular solution
Trending nowThis is a popular solution!
Step by stepSolved in 2 steps with 1 images
Knowledge Booster
Similar questions
- Programming Language: C++ Please use the resources included and provide notes for understanding. Thanks in advance. Code two functions to fill an array with the names of every World Series-winning team from 1903 to 2020, then output each World Series winner with the number of times the team won the championship as well as the years they won them. The input file is attached, along with the main function and screenprint. Please note team names that include two words, such as Red Sox, have an underscore in place of the space. This enables you to use the extraction operator with a single string variable. The following resources are included: Here is main. #include <iostream>#include <fstream>#include<string> using namespace std; // Add function declarations and documentation here void fill(string teams[], int size);void findWinner(string teams[], int size); int main(){ const int SIZE = 118;int lastIndex;string team[SIZE]; fill(team, SIZE);findWinner(team, SIZE); return…arrow_forwardTask - Using pointers to process arrays (C Language) Example #5 below expected output is 45, but from the program below its coming out to 46. Please help make it come out to 45 as expected In a TV show, each minute can be either interesting or boring. Assume that if 7 consecutive minutes are boring, then an average viewer will stop watching the show. Write a C program that calculates how many minutes that an average viewer will watch a TV show, given the interesting minutes. Assume the TV shows are 45 minutes long. Requirements Name your program project4_minutes.c. Follow the format of the examples below. The program will read in the number of interesting minutes, then read in the interesting minutes. The program should include the following function. Do not modify the function prototype. int find_minute(int *minutes, int n); minutes represents the input array for interesting minutes, n is the length of the array (the number of interesting minutes). The function returns the how…arrow_forwardVocabulary Task (C language) Solution given below. How to fix the error in the picture attached. txt file is not being created from this code please also include how to create a txt file and where will it be saved in the computer Natural language processing (NLP) is a field of artificial intelligence that seeks to develop the ability of a computer program to understand human language. Usually, the first step of an NLP system is to convert words into numeric codes. Thus, the system converts an input text into a sequence of numeric codes before any high-level analysis. This process is known as text preprocessing. We can only perform text preprocessing if we have a vocabulary of words and their associated numeric codes. Your task is to create a vocabulary of unique words for a given text file and assign a different number from 1 to N to each unique word, with N being the total number of unique words. You must perform this assignment so that the first word in alphabetical order gets the…arrow_forward
- Customized step counter Learning Objectives In this lab, you will Create a function to match the specifications Use floating-point value division Instructions A pedometer treats walking 2,000 steps as walking 1 mile. It assumes that one step is a bit over 18 inches (1 mile = 36630 inches, so the pedometers assume that one step should be 18.315 inches). Let's customize this calculation to account for the size of our stride. Write a program whose input is the number of steps and the length of the step in inches, and whose output is the miles walked. Output each floating-point value with two digits after the decimal point, which can be achieved as follows: print(f'{your_value:.2f}') Ex: If the input is: 5345 18.315 the output is: You walked 5345 steps which are about 2.67 miles. Your program must define and call the following function. The function should return the number of miles walked.def steps_to_miles(user_steps, step_length) # Define your function here if __name__…arrow_forwardC#(Sharp): I made my code and design below. Anybody can help me some correction and add some design button and code. "Need to make C# step by step design and code "Calculator where make a calculator program that can do add, subtract, multiply, divide and square root. It should have a memory save/restore function for one number. There should be a way to set the number of fraction digits displayed". Code: using System; using System.Collections.Generic; using System.ComponentModel; using System.Data; using System.Drawing; using System.Linq; using System.Text; using System.Threading.Tasks; using System.Windows.Forms; namespace AktCalc { public partial class Form1 : Form { string last = ""; bool minus = false; bool plus = false; bool divide = false; bool multiply = false; string memory = ""; public Form1() { InitializeComponent(); } private void button2_Click(object sender, EventArgs e) { if (textBox1.Text.Contains(",")) { return; } else { textBox1.Text += ","; } } private void…arrow_forwardC++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…arrow_forward
- can somone help me with this in c languagearrow_forwardMemory Management Programming Assignment Please if this can be coded in Java or C++ i would appreciate implement and test the GET-MEMORY algorithm This algorithm uses the Next-Fit(First-Fit-With-A-Roving-Pointer) technique. implement and test the FREE-MOMORY algorithm Implement the “GET_MEMORY” and “FREE_MEMORY” algorithms. Comprehensive testing must be done for each algorithm. Following are sample run results for each: GET_MEMORY IS RUNNING……… Initial FSB list FSB# Location Size 1 7 4 2 14 10 3 30 20 . . . . . . Rover is 14 ---------------------------------------------------------------------------- Allocation request for 5 words Allocation was successful Allocation was in location 14 FSB# Location Size 1 7 4 2 19 5 3 30 20 . . . . . . Rover is 30 ---------------------------------------------------------------------------- Allocation request for 150 words Allocation was not successful . . . __________________________________________________________ FREE_MEMORY…arrow_forward// LargeSmall.cpp - This program calculates the largest and smallest of three integer values. #include <iostream> using namespace std; int main() { // This is the work done in the housekeeping() function // Declare and initialize variables here int largest; // Largest of the three values int smallest; // Smallest of the three values // Prompt the user to enter 3 integer values // Write assignment, add conditional statements here as appropriate // This is the work done in the endOfJob() function // Output largest and smallest number. cout << "The largest value is " << largest << endl; cout << "The smallest value is " << smallest << endl; return 0; }arrow_forward
- Programming Language: C++ Please use the resources included and provide notes for understanding. Thanks in advance. Code two functions to fill an array with the names of every World Series-winning team from 1903 to 2020, then output each World Series winner with the number of times the team won the championship as well as the years they won them. The input file is attached, along with the main function and screenprint. Please note team names that include two words, such as Red Sox, have an underscore in place of the space. This enables you to use the extraction operator with a single string variable. The following resources are included: Here is main. #include <iostream>#include <fstream>#include<string> using namespace std; // Add function declarations and documentation here void fill(string teams[], int size);void findWinner(string teams[], int size); int main(){ const int SIZE = 118;int lastIndex;string team[SIZE]; fill(team, SIZE);findWinner(team, SIZE); return…arrow_forwardLAB RESTRICTIONS, PLEASE READ:- Do not add any imports, the ones that you need will be given to you.- Do not use recursion.- Do not use try-except statements, you should be able to anticipateor prevent any errors from happening at all! - Code in python - Should work for given doctest def longest_unique_substring(s: str) -> str:"""Given a string <s>, return the longest unique substring that occurs within<s>.A unique substring is a substring within <s> which DOES NOT have anyrepeating characters. As an example, "xd" is unique but "xxd" is not.If there are two equal length unique substrings within <s>, return the onethat starts first (i.e., begins at a smaller index). >>> longest_unique_substring('aab')'ab' """arrow_forwardProgramming Language: C++ 4. Select the two correct statements about stub functions: Select one or more: a. stubs are used to test the functionality of a program b. stubs must return a value c. stubs are programs that test if a called function returns the correct result d. stubs are simpler than the functions they replacearrow_forward
arrow_back_ios
arrow_forward_ios
Recommended textbooks for you
- Computer Networking: A Top-Down Approach (7th Edi...Computer EngineeringISBN:9780133594140Author:James Kurose, Keith RossPublisher:PEARSON
Computer Organization and Design MIPS Edition, Fi...Computer EngineeringISBN:9780124077263Author:David A. Patterson, John L. HennessyPublisher:Elsevier Science
Network+ Guide to Networks (MindTap Course List)Computer EngineeringISBN:9781337569330Author:Jill West, Tamara Dean, Jean AndrewsPublisher:Cengage Learning 
Concepts of Database ManagementComputer EngineeringISBN:9781337093422Author:Joy L. Starks, Philip J. Pratt, Mary Z. LastPublisher:Cengage Learning
Prelude to ProgrammingComputer EngineeringISBN:9780133750423Author:VENIT, StewartPublisher:Pearson Education
Sc Business Data Communications and Networking, T...Computer EngineeringISBN:9781119368830Author:FITZGERALDPublisher:WILEY
Computer Networking: A Top-Down Approach (7th Edi...
Computer Engineering
ISBN:9780133594140
Author:James Kurose, Keith Ross
Publisher:PEARSON
Computer Organization and Design MIPS Edition, Fi...
Computer Engineering
ISBN:9780124077263
Author:David A. Patterson, John L. Hennessy
Publisher:Elsevier Science
Network+ Guide to Networks (MindTap Course List)
Computer Engineering
ISBN:9781337569330
Author:Jill West, Tamara Dean, Jean Andrews
Publisher:Cengage Learning
Concepts of Database Management
Computer Engineering
ISBN:9781337093422
Author:Joy L. Starks, Philip J. Pratt, Mary Z. Last
Publisher:Cengage Learning
Prelude to Programming
Computer Engineering
ISBN:9780133750423
Author:VENIT, Stewart
Publisher:Pearson Education
Sc Business Data Communications and Networking, T...
Computer Engineering
ISBN:9781119368830
Author:FITZGERALD
Publisher:WILEY