Please explain right answer How does reverse methylation affect gene expression?Select one:o a The gene is turned off, but still expresses a protein product.b. The gene becomes transcriptionally silent.O C. There is no effect on the gene.d. The gene is hyperactive resulting in a gain of function.e. The gene expresses the wrong protein.Clear my choice

DNA methylation is associated with the silencing of gene expression.

ct one: a The gene is turned off, but still expresses a protein product. . The gene becomes transcriptionally silent. There is no effect on the gene. The gene is hyperactive resulting in a gain of function. The gene expresses the wrong protein.

ct one: a The gene is turned off, but still expresses a protein product. . The gene becomes transcriptionally silent. There is no effect on the gene. The gene is hyperactive resulting in a gain of function. The gene expresses the wrong protein.

Concepts of Biology

1st Edition

ISBN:9781938168116

Author:Samantha Fowler, Rebecca Roush, James Wise

Publisher:Samantha Fowler, Rebecca Roush, James Wise

Chapter9: Molecular Biology

Section: Chapter Questions

Problem 11RQ: Post-translational control refers to: a. regulation of gene expression after transcription b....

See similar textbooks

Related questions

Q: explain gene targeting in embryonic stem cells?

A: Embryonic stem cells are characterized by the potency to generate different cell types and are…

Q: D. What is the best term for a normal INK gene? (tumor suppressor) (inactive tumor suppressor)…

A: Tumor-suppressor genes are those genes which do not allow the cell to grow rapidly and in an…

Q: A young child with cretinism is not growing and her parents would like her to take synthetic hGH.…

A: Introduction :- When thyroid glands are underactive or hypothyroid from birth, it is referred to as…

Q: Determine the membrane potential inside the cell and its unit of expression.

A: Over their membrane, every living cell maintains a potential difference. Simply said, differences in…

Q: b) Use the DNA sequence below to answer the following questions. 3'- TACGAACGAGTGCCCCAAAATT -5' What…

A: The process of converting DNA instructions into proteins is known as the central Dogma.

Q: side from cancer, what are other diseases and abnormalities in living organisms?

A: Disease is a condition in which there is suffering not only physically but also mentally. A disease…

Q: Describe how tumors are diagnosed.

A: An abnormal mass of tissue that forms once cells grow and divide quite they {should|they ought…

Q: A. List and explain some (2-3) control mechanisms of the body in order to prevent abnormalities and…

A: Q A. List and explain some (2-3) control mechanisms of the body in order to prevent abnormalities…

Q: b. How is the DNA information used to make proteins for ongoing cellular processes and cellular…

A: Introduction DNA is the molecular structure that is composed of a pair of polynucleotide chains and…

Q: explain how mutagens can cause mutations and the impact mutations have on protein synthesis and…

A: A mutation is a change in our DNA sequence that arises as a consequence of errors during DNA…

Q: What are 3 effects of Stem Cell Treatment to a person? Explain each answer in your own words.

A: A stem cell transplantation, also known as a bone marrow transplant, is a medical procedure that…

Q: Distinguish between atrophy, necrosis, and apoptosis, and describe a circumstance under which each…

A: The event of the biological ceasing of a cell to carry out its functions is called cell death. This…

Q: Disruption in the pathway of apoptosis & autophagy can lead to different diseases”- explain briefly

A: Apoptosis is a type of programmed cell death that consists of biochemical events resulting in…

Q: In denaturation of DNA and protein explain how denaturation brings about the ailment and what its…

A: Protein Denaturation: A cell death is symbolized by the advent consequence of…

Q: explain the difference between benign and malignant tumors?

A: Tumors are unwanted and extra growth of cells.

Q: Define the term target cell?

A: Cells are the smallest basic and fundamental units of life and so are also referred to as the…

Q: Explain key risk factors for cancer, and identify which risks are preventable, given current…

A: Cancer means the abnormal growth of cells or the new growth of cells that has an adverse impact on…

Q: Pattern Reduced gene Displays recognition Cytokines expression protein synthesis PAMPS receptors…

A: An antigen is any molecule that stimulates an immune response. So PAMPs Ara type of antigen that may…

Q: Explain about Gene Mutations and Cancer ?

A: A gene is a unit of hereditary present in thousands of numbers on the helical strands of…

Q: b) What is one reason that it is challenging to treat cancer?

A: The uncontrolled set of cell divisions give rise to cancer cells. This happens so, when the control…

Q: Explain why a loss or an excess in genetic material leads to the expression of an abnormal

A: Introduction :- Mutations are changes in a gene's DNA that are abnormal. Bases are the basic…

Q: a. Explain each of the three primary processes involved in mRNA processing in detail.

A: RNA splicing It is a form of RNA processing in which a newly made precursor mRNA is transformed into…

Q: Explain about suppressor mutation ?

A: Suppressor mutation is a second mutation.

Q: How gene expression is controlled? (min 500 words)

A: The genes are the components of the genome that direct specific functions in the cell. Their…

Q: Explain the functions of stem cells, and summarize the stages ofhematopoiesis.

A: Stem cells are defined as undifferentiated cells that differentiate into specific cells if the body…

Q: Explain circadian rhythms in terms of gene expression.

A: " ANSWER Circadian rhythms Are powered with the aid of an intrinsic timing machine this is…

Q: explain the similarities between benign and malignant tumors?

A: Cancer is uncontrolled, abnormal excessive division of cells. Differences Benign tumour 1. Slow…

Q: Discuss tissue transplant rejection and how it is treated.

A: Tissue or organ transplant is a process in which damaged or severely injured tissue or organs are…

Q: Briefly discuss tumorigenesis, cancer progression, and cancer treatments.

A: Tumors are masses of tissue that form as a result of aberrant, uncontrolled, disorganized, and…

Q: (a) How does the duplication of individual genes occur? (b) individual that inherit a genetic…

A: Mutation in the DNA can change our genetic material that can causes changes in our phenotype as…

Q: A DNA sequence looks like this: GAA GAG GGG GCG - Translate it to mRNA - Describe how you have…

A: The conversion of DNA to mRNA is known as translation.

Q: indicate if TRUE or FALSE 1. Cactus is an inhibitory protein.

A: Note: As Per Guidelines, We Can Answer One Question At A Time. Ask Again To get rest answers.…

Q: Define CRP along with an example.

A: Introduction: Proteins are one of the major macromolecules that perform varieties of functions in…

Q: Distinguish between benign and malignant tumors, theircharacteristics, and terminology.

A: Cancer It is defined as growth of abnormal cells characterized by cellular malfunction. Risk factors…

Q: Define induction and types of induction.

A: The sexually reproducing animals develop a zygote after fertilization which then undergoes repeated…

Q: Identify An illness characterized by mutations that disrupt normal control mechanisms and produce…

A: Alterations to the DNA sequence that make up a gene are known as mutations. Environmental influences…

Q: What is mRNA surveillance ?

A: Replication refers to a process by more copies of DNA are formed on a template DNA. Synthesis of RNA…

Q: How are tissue-specific transcription factors regulated? Identify three different ways

A: Transcription factors are the type of proteins that bind to the specific sites in the DNA and…

Q: Differentiate gene therapy from stem cell therapy

A: A gene is a segment of DNA which encodes a particular protein and can be expressed. The expression…

Q: Explain the process of transcription, including the location, processes, and molecules involved.

A: Transcription is the first of several steps of DNA based gene expression in which a particular…

Q: Discuss the relationship between genes and phenotype in terms of gene expression and the symptoms…

A: Units of inheritance are called genes. Genes are the DNA regions that encode proteins. Each gene…

Q: NCREASED/DECREASED transcription of target genes. Select one: O a. Decreased ; Decreased O b.…

A: GTPase-Activating Proteins or GAPs act by binding to the GTPase. This enhances the hydrolysis of…

Q: (c) Discuss the process of replication of DNA.

A: When a cell divides, DNA replicates itself via the process of replication.

Q: Explain epigenetic changes

A: Epigenetic: is the study of changes in organisms caused by modification of gene expression rather…

Q: What are the purpose of multisystemic therapy?

A: MST (Multisystemic Therapy) is an intense family and community-based treatment for serious juvenile…

Q: Explain Mutations in tumor-suppressor genes are recessive at the cellular level but dominant at the…

A: Cancer is a group of diseases involving abnormal growth of cells, which tend to proliferate in an…

Q: . Why is chronic inflammation a risk factor for cancers? Indicate as many answers as apply. O…

A: In chronic inflammation, the process of inflammation begins even if no injury does not end. An…

Q: Define and Cancer ,differentiate between a benign tumor and amalignant tumor, using examples.

A: Cancer is also known as malignancy and it is a disease in which abnormal growth of cells takes place…

Q: Explain how most cells can have the same genetic content and yet have different functions in the…

A: The genome of a cell contains in its DNA sequence the information to make many thousands of…

Concept explainers

Clinical Pharmacology

Pharmacology is a discipline of medicine that studies how medications interact with the systems and processes of living organisms, focusing on drug action mechanisms as well as therapeutic and other purposes.

Question

Please explain right answer

How does reverse methylation affect gene expression?
Select one:
o a The gene is turned off, but still expresses a protein product.
b. The gene becomes transcriptionally silent.
O C. There is no effect on the gene.
d. The gene is hyperactive resulting in a gain of function.
e. The gene expresses the wrong protein.
Clear my choice

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

If a mutation occurred in a control element sequence associated with a particular gene, which of the following would be a likely consequence of this? A. This mutation is not likely to affect the expression of the associated gene, because RNA polymerase does not bind to control elements. B. This will likely affect the expression of the associated gene because it will loosen the coiling of chromatin at this site. C. The expression of the associated gene will be affected because this change will result in a nonsense mutation. D. This mutation is not likely to affect the expression of the associated gene, since control elements are noncoding sequences. E. The associated gene's expression would likely be affected, since this mutation would change the ability of at least one transcription factor to bind.
You are curious to identify the region of the gene X sequence that serves as an enhancer for gene expression. Design an experiment to investigate this issue.
What strategy does a genetically encoded calcium indicator look like to allow fluorescence imaging of only one cell type in an acute slice of the brain? A.The use of fluorescent protein expression inhibitors in other cells B.The injection of a recombinant virus causing the death of other cells C.The use of a promoter specific to these cells D.Activation of membrane receptors specific to these cells
Can one transcription factor sometimes act as a repressor and sometimes act as an activator? a. Yes, but it depends on where the transcription factor binds in the promoter b. Yes, but it depends on other proteins that might act with the transcription factor c. No, transcription factors are always either activators or repressors d. Yes, but only if a mutation happens
Why is regulating transcription the main way that cells control gene expression? A. Because transcription is the last step in gene expression, stopping here ensures that the cell has a stockpile of proteins to prepare them from all unexpected environmental changes. B. Because transcription involves interactions with DNA, preventing transcription reduces the changes of mutation in the cell’s genome. C. Because transcription is the first step in gene expression, stopping at transcription reduces the amount of energy and resources used by producing unnecessary gene products. D. Because transcription is the shortest step in gene expression, preventing transcription has little effect on the rate of protein production.
For each statement about gene expression mechanisms, choose the correct end to the sentence. For each gene, the template strand for transcription is determined by…. The direction of translation is determined by…… The tissue-specificity of protein production is determined by…. choices: a. location of the start codon b. location of the promoter c. direction of polymerization by RNA polymerase d. none of these e. direction of movement of ribosomes f. overall orientation of the chromosome
Which of the following best represents the central dogma of geneexpression?a. During transcription, DNA codes for polypeptides.b. During transcription, DNA codes for mRNA, which codes forpolypeptides during translation.c. During translation, DNA codes for mRNA, which codes forpolypeptides during transcription.d. none of the above
Transcriptional repressor proteins (e.g., lac repressor), antisense RNA, and feedback inhibition are three different mechanisms that turn off the expression of genes and gene products. Which of these three mechanisms will be most effective in each of the following situations? A. Shutting down the synthesis of a polypeptide B. Shutting down the synthesis of mRNA C. Shutting off the function of a protein For your answers to parts A–C that list more than one mechanism, which mechanism will be the fastest or the most efficient?
Which of the following is true of CpG islands? a. They are methylated near promoters of actively transcribed genes. b. They are unmethylated near promoters of actively transcribed genes. c. Acetylation of CpG islands leads to repression of transcription. d. CpG islands code for RNA molecules that activate transcription.
What is effect of turning on and off of genes? How do we measure gene expression? What is gene regulation, explain extensively?
What is a regulatory enhancer? Group of answer choices the protein in areas surrounding the gene a section of DNA that targets proteins for degradation and thus stops the expression of the unwanted genes a section of DNA that is involved in regulating gene expression a functionless gene copy that is the result of gene duplication Next
During X inactivation, all but one gene get silenced on one X chromosome. Why does one gene escape the inactivation? A) That is the gene responsible for inactivating the others B) Two copies of that gene are needed in females, so both are active C) X inactivation is rarely complete, so occasionally one or two genes get activated by mistake D) That is the gene that encodes the methyltransferase needed to methylate the genome.