Q: Label the parts of the cat's ovary focused under HPO. refer to the guide questions a. b. c. d. e.
A: Answer Cats ovary parts names
Q: Radioisotopes are frequently used to label molecules in a cell. The fate of atoms and molecules in a...
A: The different biomolecules perform different functions within the cells. From the nucleus to the pla...
Q: How do human activities negatively affect biodiversity? Cho A introducing invasive species
A: The three human activities negatively affect biodiversity that apply - introducing invasive speci...
Q: What is a DNA nucleotide? A chain of DNA subunits The building block, or basic unit, of DNA A deoxyr...
A: DNA is a double helical molecule. It is found in the nucleus of the cell in the chromosome. It acts ...
Q: Which of the following neurotransmitters does NOT have one NH2 unit in its structure? O serotonin O ...
A: Neurotransmitters are specific molecules that are released from the presynaptic neuron and responsib...
Q: explain why spherocytes and sickle cells will decrease the ESR. Your answer
A: The fluid in the body that delivers oxygen and nutrients to the cells, as well as removes metabolic ...
Q: When using the comparative method (planned comparisons) to study why Violet-throated Starfrontlet (a...
A: Answer : a. A closely related species of starfrontlet that has an unusual haemoglobin protein.
Q: Consider the following estimates:(a) There are 7 x 109 humans living on this planet.(b) Each individ...
A: Answer - a) There are currently 1.4×109 mutations present in the human population. this is calculate...
Q: Which of the following levels of protein structure may be affected by hydrogen bonding? (a) primary ...
A: Protein is the biomolecule which comprise the one or more long chain of amino acids which belongs to...
Q: How might early dog domestication compare with pet dog breeding in the U.S. today? Explain in detail...
A: Early dog domestication- It's found that the earliest dogs in US were not domesticated from local wo...
Q: What is this figure showing (overall first)? What is happening at each step? How are the little circ...
A: The neurons are the cells of the nervous system that are responsible for the generation and transmis...
Q: Metabolism is built on two distinctly different types of pathways: catabolic and anabolic. Which of...
A: Sun is the only source of energy on the Earth. This energy is harnessed by plants. The light energy ...
Q: Suppose Melissa started growing four o'clock plants, Mirabilis jalapa, in her garden. She noticed th...
A:
Q: What is the problem with talking about human pheromone activity? O The words are really difficult to...
A: Pheromones are mild to strong chemicals secreted by organisms. In birds and other animals these act ...
Q: give 5 topics in relation to teenagers health
A: Sexual Health: - Teenage is the time when humans start exploring sexual aspects and hence is associa...
Q: Antisocial personality disorder is woven of both biological and psychological strands. Discuss
A: Antisocial personality disorder (ASPD) is a typical mental health condition. People with ASPD may no...
Q: me this teedback system. 4- Identify all the components of this particular feedback system and speci...
A: Answer 4: - Increased Temperature sensed by Receptors in Hypothalamus> More blood directed to ski...
Q: Why are all of the fossil taxa from the Pliocene in this module called hominins?
A: Fossils are the preserved remains of plants and animals that were buried beneath ancient oceans, lak...
Q: What effect does melatonin have on the body? O. Increased levels cause alertness Two of these answer...
A:
Q: D Question 4 Which mass extinction led to the disappearance of the dinosaurs? O Triassic O Cretaceou...
A: The recurrent rise and disintegration of ice sheets and glaciers driven by the Milankovitch cycles, ...
Q: In Neurospora, the mutant stp exhibits erratic stop-andstart growth. The mutant site is known to be ...
A: mtDNA stands for mitochondrial DNA. If an stp strain is used as the female parent in a cross with a...
Q: This photograph was taken in 2004, 24 years after Mount Saint Helens erupted. Compare and contrast t...
A: The Mount Saint Helens Volcano destroyed many plants, animals, etc. But through the process of succe...
Q: Question 1: Most (but not all) of the important functional groups on biological molecules a. contain...
A: A biomolecule, also known as a biological molecule, is any of the many compounds created by cells an...
Q: What are long terminal repeat (LTR) ?
A: Long terminal repeat are repetitive sequence of DNA found at the end of pro-viral DNA after reverse ...
Q: 2. Provide the sequences of the template and coding strands of a DNA double helix that was used to p...
A: The RNA or ribonucleic acid is produced from the DNA by the transcription process. RNA is used for t...
Q: Explain the types of retrotransposons ?
A: Type of genetic component which copy and paste themselves into different genomic location by the pro...
Q: Rhodophyta are able to live at extreme depths for photosynthetic organisms due to the within their c...
A: “Since you have asked multiple question, we will solve the first question for you. If you want any s...
Q: The term anaxonic means; With an axon None of these is correct Without an apparent axon O Non-dendri...
A: Neurons are fundamental units of brain and mervous system. They transmit information to the other ne...
Q: Where is information stored in DNA? O In the carbons of deoxyribose sugar O In the order of the nitr...
A: The DNA or deoxyribonucleic acid is the genetic material in living organisms that is present in the ...
Q: Name 3 organs system in the human body??
A: All living bodies-plants, animals or microscopic organisms, are made up of cells. The term 'cell' is...
Q: What type of trait and genetic interactions are shown below? Environment Gene 1 Phenotype Gene 2 Gen...
A: Option c
Q: Parts of the Microscope 20. 19. 2. 18. 3. 17. 4. 16. 5. 15. 6. 14. 7. 13. 8. 12. 11. 10. 9.
A: It is a phase contrast microscope. It is a light microscope and it is used to enhance the contrast o...
Q: On a summer trip to the Galapagos you collect two finch species, Geospiza fortis and G. pauper and b...
A: Geospiza pauper is also known as medium tree finch, categorized under critically endangered.
Q: What are the specific ways in which individuals and environments interact?
A: In this nature, individual and environment are interactive with each other. Interaction is necessary...
Q: The figure here shows oxygen concentration in a suspension of isolated mitochondria. Immediately aft...
A: Cellular respiration involves breakdown of glucose and production of energy in the form of ATP. Diff...
Q: label what is being pointed at the human ovary
A: Introduction: The Graafian follicle is a fully grown follicle that ruptures during the ovulatory pha...
Q: A container with two amoebas splits and double its size once every second. The container will be com...
A: Amoeba is a single-celled organism that reproduces asexually. Asexual reproduction involves the divi...
Q: As we have learned in our discussions of natural selection, the ability to respond successfully to s...
A: Lactose is the main carbohydrate in milk and is a major energy source for most young mammals. The en...
Q: Count the significant digits in each of these measurements: number of significant digits ? measureme...
A: Rules for significant digits: All non zero digits are significant digits. The zeroes between the si...
Q: Upon examining the test results for the unknown carbohydrate from all the tests depicted in the imag...
A: A biomolecule is a molecule created by live cells or organisms. The most common biomolecules include...
Q: Define about lactose (lac) operon ?
A: The lactose operon also known as the lac operon is a set of genes that are specific for uptake and m...
Q: Give the methods of transposition ?
A: Deoxyribonucleic acid or DNA is a hereditary material that transfers from one generation to another....
Q: How do we isolate culture media (step by step process) and what is the purpose of bacterial culture ...
A: Introduction :- Microorganisms can be found in the natural environment, such as soil. They coexist w...
Q: 4. A patient With food indigestion has been screened and dlagnosed with steatorrhea (the excretion o...
A: Solution: Steatorrhea: it is a condition in which undigested fat are excreted out through faeces. C...
Q: What molecule is involved in organism to organism communication? O Hormones O Sebaceous sweat glands...
A: Pheromones are chemical messengers and chemical signals produce by animals.
Q: What happens when you eat? How does a breakfast of scrambled eggs with spinach and multi-grain toast...
A: Introduction: Nutrients are components in food that an organism uses to survive and grow. They are ...
Q: Assume that diploid plant A has a cytoplasm genetically different from that of plant B. To study nuc...
A: Pollination is the process of transporting pollen from the anther (male part of a flower) to the sti...
Q: Calculate the percentage of the total calories per serving that come from total fat. • Based on a 2...
A: To calculate this , divide a food / drinks calories from fat by total calories (this information giv...
Q: Explain comprehensively the secondary growth in dicotyledonous plant stem from the very early stage ...
A: Dicotyledonous Stem The transverse section of a typical young dicotyledonous stem shows that the epi...
Q: TGGCGGCATTTTAACTTTCTTTAATGAATGCGGGCATATTTAATACGCGCTATGCGCATCGTATGCGAT-3' 1) What are the first five ...
A: Exons forms the final RNA transcripits and the introns are removed by RNA splicing. 1)first 5 deoxyr...
Step by step
Solved in 2 steps
- Testing Biological Control Biological control agents are used to battle red imported fire ants. Researchers have enlisted the help of Thelohania solenopsae, a natural enemy of the ants. This microsporidian (Section 23.4) is a parasite that infects ants and shrinks the ovaries of the colony's egg-producing female (the queen). As a result, a colony dwindles in numbers. Are these biological controls useful against imported fire ants? To find out, USDA scientists treated infested areas with either traditional pesticides or pesticides plus biological controls (both flies and the parasite). The scientists left some plots untreated as controls. FIGURE 45.16 shows the results. FIGURE 45.16 A comparison of two methods of controlling red imported fire ants. The graph shows the numbers of red imported fire ants over a 28-month period. Orange triangles represent untreated control plots. Green circles are plots treated with pesticides alone. Black squares are plots treated with pesticide and biological control agents (parasitoid flies and a microsporidian parasite). How did population size in the control plots change during the first four months of the study?What are avirulence genes?a. plant genes that encode proteins that prevent infection (virulence)b. plant genes that cause infection when the proteins they encode bindto pathogen elicitorsc. pathogen genes that prevent the pathogens from causing plantdiseased. pathogen genes that encode elicitors that foster diseasein plantse. None of the above correctly describes avirulence genes.Rhizobium is important agriculturally because it supplies __________ to plants such as peas and beans. View Available Hint(s) for Part A oxygen sulfur fixed nitrogen carbon
- If a bacteria cell is F+, that cell must be capable of transduction. contain the fertility factor. be capable of transformation. contain antibiotic resistant plasmids.Hookworms, parasitic nematodes transmitted through contact between bare feet and soil,infect nearly a half billion people. In the small SE Asian nation of Timor-Leste, infection rates insome regions approach 70%, and the resulting anemia from these infections has a serious impacton quality of life. Health officials are concerned by a recent rise in Ivermectin-resistant cases inthe isolated enclave of Oecussi, and are worried about these drug resistance genes spreading tothe capital Dili, 165 km away. You genotype diploid female hookworms, Ancylostoma ceylanicum,from 100 patients in each location for a neutral locus with two alleles A1 & A2.You find the following genotypic count data: A1/A1 A1/A2 A2/A2 Oecussi 36 48 16 Dili 9 42 3a. Use these data to calculate FST between these two populations. 3b. Assuming that these two populations are in drift/migration equilibrium, what is the effectivenumber of migrants moving between them each generationMake a spider key please on the ff organisms asap
- Seedsbearing eliasomes are likely to be dispersed by:a.ants.b.wind.c.water.d.birds.e.scatterhoarding mammals.Meristem culture helps in developing which of the following?a) Tall plantsb) Disease resistant plantsc) Virus free plantsd) Hybrid plantsEnergy Efficiency of Biofuel Production Most of the plant material currently used for biofuel production consists of food cropsmainly corn, soybeans, and sugarcane. In 2006, David Tilman and his colleagues published the results of a 10-year study comparing the net energy output of various biofuels. The researchers grew a mixture of native perennial grasses without irrigation, fertilizer, pesticides, or herbicides, in sandy soil that was so depleted by intensive agriculture that it had been abandoned. They measured the usable energy in biofuels made from the grasses, and also from com and soy, then measured the energy it look to grow and produce biofuel from each kind of crop (Figure 6.1). FIGURE 6.1 Energy input and output of biofuels made from three different crops. One hectare is about 2.5 acres. About how much energy did ethanol produced from one hectare of corn yield? How much energy did it take to grow the corn to make that ethanol?
- Testing Biological Control Biological control agents are used to battle red imported fire ants. Researchers have enlisted the help of Thelohania solenopsae, a natural enemy of the ants. This microsporidian (Section 23.4) is a parasite that infects ants and shrinks the ovaries of the colony's egg-producing female (the queen). As a result, a colony dwindles in numbers. Are these biological controls useful against imported fire ants? To find out, USDA scientists treated infested areas with either traditional pesticides or pesticides plus biological controls (both flies and the parasite). The scientists left some plots untreated as controls. FIGURE 45.16 shows the results. FIGURE 45.16 A comparison of two methods of controlling red imported fire ants. The graph shows the numbers of red imported fire ants over a 28-month period. Orange triangles represent untreated control plots. Green circles are plots treated with pesticides alone. Black squares are plots treated with pesticide and biological control agents (parasitoid flies and a microsporidian parasite). How did population size in the two types of treated plots change during this same interval?Testing Biological Control Biological control agents are used to battle red imported fire ants. Researchers have enlisted the help of Thelohania solenopsae, a natural enemy of the ants. This microsporidian (Section 23.4) is a parasite that infects ants and shrinks the ovaries of the colony's egg-producing female (the queen). As a result, a colony dwindles in numbers. Are these biological controls useful against imported fire ants? To find out, USDA scientists treated infested areas with either traditional pesticides or pesticides plus biological controls (both flies and the parasite). The scientists left some plots untreated as controls. FIGURE 45.16 shows the results. FIGURE 45.16 A comparison of two methods of controlling red imported fire ants. The graph shows the numbers of red imported fire ants over a 28-month period. Orange triangles represent untreated control plots. Green circles are plots treated with pesticides alone. Black squares are plots treated with pesticide and biological control agents (parasitoid flies and a microsporidian parasite). If this study had ended after the first year, would you conclude that biological controls had a major effect?Bacteriophage-Inspired Antibiotics Although bacteriophages have been infecting bacteria for billions of years, no mechanism, has evolved in bacteria to prevent the viruses from lysing the cell walls of their hosts. Now, scientists are targeting the same bacterial wall components that bacteriophages do. The goal is to develop antibiotics that bacteria will be less likely to develop resistance to. FIGURE 20.22 shows the results of a study to test Epimerox, a new bacteriophage-inspired antibiotic, against Bacillus anthracis, the bacterial species that causes the disease anthrax. FIGURE 20.22 Effect of Epimerox on the survival of mice with anthrax. Mice were infected with the bacteria B. anthracis. One group of 15 then began receiving a drug-free buffer solution 3 hours later. Another 15 were treated with Epimerox beginning 3 hours after infection. A third group of 15was treated with Epimerox beginning 24 hours after infection. In studies with Bacillus anthracis cells grown in culture, no Epimerox-resistant cells were observed. Explain why this result is consistent with the scientists' goal for developing this drug.