Describe the factors that affect diffusion at the molecular level? Describe physiological mechanisms in at least three systems as examples of how animals address these factors.

Q: hich of the following figures represents tive enzyme? Substrate Figure 1 Figure 1 Figure 2 Figure 3…

A: Figure no 3

Q: Fever is a sign of pathogen infection. Statement 2: Vasodilation is a type of immune response that…

A: The immune response is the action of the body generated on encountering a foreign particle called…

Q: 4.Which of the following immune responses occurs when a cytotoxic T cell is activated? Note: This is…

A: Cytotoxic T cells:  A cytotoxic T cell (CD8+ T cell) is a lymphocyte that is responsible for…

Q: 2. The genotype of F₁ individuals in a tetrahybrid cross is AaBb assortment of these four genes,…

A: A trait is characteristic feature that is unique to particular individual. A tetrahybrid cross is a…

Q: Which of the following is a contrast in genetics organization between COVID19’s RNA & human DNA a)…

A: DNA and RNA are the two primary categories of nucleic acids. Nucleotides, which have a five-carbon…

Q: The step(s) involved in cell signaling are: O Signaling cell synthesizes and secretes a signaling…

A: Introduction As multicellular organisms are made up of a lot of cells, there must be coordination…

Q: 5. Larry and Lola Little have achondroplasia, a form of dwarfism. Both are heterozygotes. Their son,…

A: Heterozygous condition is defined as a condition in which two variations of a gene known as alleles…

Q: formation of different cellular phenotypes is due to the equal distribution of the cytoplasmic…

A: Phenotype shows the appearance of individual.  genotypes shows the genetic type.

Q: What is the role of the substrate? Is it really necessary to add substrates in ELISA? Why, or why

A: * ELISA is called as enzyme linked immunoassay which is used to detect antibodies in blood. *An…

Q: Describe the traits common to all fishes.

A: Fishes are diverse. They have evolved to live successfully in underwater environment, from streams…

Q: What does this diagram illustrate? Complete the labels.

A: Bacteriophage is a specific virus that can infect the bacteria. These can cause severe damage to the…

Q: 1. 2. 3. 4. 5. Most Recent Varieties STRAWBERRY Its Characteristics How It Was Developed

A: Strawberries are available in different varieties the sweet aromatic flavour is widely considered…

Q: Questions 3 and 4 refer to the following diagram. Tertiary Consumer Snake Secondary d Consumer Toad…

A: The strata is very important in various ecological cycles as it keeps the consumers and producer…

Q: ndustrial effluent from a metal processing factory released Cu into a nearby river without any…

A: Introduction The act of observing and measuring the state and continuing changes in ecosystems,…

Q: Isotype refers to: different light chain constant region O different heavy chain variable regions O…

A:

Q: A) For this DNA fragment "TGAATTCCCGGGTTCCGGGAATTCGCGCGAATT CCCGGTATA", what is its complementary…

A: As per our Guidelines we are not allowed to answer more than three sub parts at a time.

Q: What Characteristics of Phosphorous minerals makes them suitable to be used as fertilizers?

A: Most common form of phosphorus is Diammonium phosphate and monammonium phosphate,NPK etc. NPKs is a…

Q: What are the key steps of transformation, tumorigenesis and metastasis on a cellular and tissue…

A: Transformation is a process in which a normal cell is transform into a cancerous cell  Tumor genesis…

Q: Which of the following diet-derived compounds have epigenetic effects? O folic acid O vitamin B12…

A: ANSWER;- Folic acid Explain;- Folate, along with other B-nutrients, assumes an urgent part in the…

Q: DODO 0 0 Consider the characteristics given on the first column of Table 18. Put a check on the…

A: When researching biological entities, following a predefined hierarchy and order makes it easier to…

Q: What feature do plasmodesmata have? What function do they have in plants?

A: Plasmodesmata are intercellular pores that connect adjacent plant cells, permitting membrane and…

Q: Explain the significance of satellite DNA in DNA profiling technique

A: Deoxyribonucleic acid or DNA is a polymer composed of two polynucleotide chains that coil around…

Q: Examine the network motifs in Figure Q8–5.Decide which ones are negative feedback loops and whichare…

A: Introduction  Protein is the key biomolecule in the biological system, any important physiological…

Q: in the fruit fly, genes for rRNA can be replicated more or less often compared to the rest of the…

A: The regulation of the quantities of protein generated from its mRNA is known as translational…

Q: In Labrador retrievers, some puppies have pink noses and some have black. Labrador retrievers with…

A: *Given that In Labrador retrievers some puppies have pink noses and some have black noses * And…

Q: If there were no lynx controlling the snowshoe hare population, what would eventually happen to the…

A: Introduction The term "population" usually refers to the number of people living in a specific area,…

Q: 5. Examine the photo of the Trillium flower pictured at the right. (a) Is Trillium a monocotyledon…

A: Introduction Trillium is a genus of herbs belonging to the lily family with an upright stem…

Q: .People with Type O blood lack antigens on the blood cells, if a patient with Type B blood receives…

A: INTRODUCTION Organs, white blood cells, proteins, and chemicals make up the immune system, which is…

Q: How do prokaryotes reproduce? What mechanisms result in gene transfer?

A: Introduction:- Prokaryotes are creatures without a nucleus or other organelles in their cells.…

Q: arasympathethic stimulation of the lungs causes   bronchi to dilate bronchioles to dilate bronchi to…

A: The autonomic nervous system is divided into the parasympathetic nervous system and the sympathetic…

Q: How does hydrochloric acid aid in the digestion of food?     Hydrochloric acid breaks down the…

A: HCl helps in digestion of protein. It protects body from infection.

Q: Make a food web consisting of (rice, cooking oil, oyster sauce, green peas, Onion, Garlic, Egg

A: There are lot of common points in between the several food chains. These common points form the…

Q: How does gastrointestinal tract evade dehydration? Alternating wave-like contraction and relaxatio…

A: Q) How does gastrointestinal tract evade dehydration? Normal peristalsis movement in the large…

Q: Describe how it is that when a short tandem repeat (STR) genomic region is PCR-amplified you can get…

A: * PCR is known as Polymerase chain reaction , a method which is used to make billions of copies of…

Q: 14.Which is an air sac that surrounds the lung capilliaries? Read and analyze the question and…

A: Bronchus is basically the wind track that leads to the lungs from trachea. So this can't be the…

Q: The presence and orientation (direction) of integral glycoproteins indicates that the plasma…

A: The plasma membrane is also known as the Cell Membrane. It is a vital component of a cell that…

Q: Allan, a 12th grader, had pancit for lunch. Later on, he observed some itchiness and rashes on his…

A: * Allergies are nothing bur your bodys reaction to harmless substance like pollen grains and  molds…

Q: heterozygous mice for the Sd gene are shown to have relatively shorter or lack a tail true or false

A: Sd / wildtype = heterozygous = short tail  Wild type/ wild type = homozygous = long tail  Sd/Sd…

Q: Define death in physiological terms. We know that when the human heart stops beating, it can be…

A: The cardiovascular system is a network of arteries and veins in which the heart pumps blood. One of…

Q: Arrange the groups in order in which they evolved. ___ 1 (earliest)           a. Jawless fishes ___…

A: The marine ecosystem is defined as the largest aquatic environment with high levels of salt in the…

Q: major cause of septic shock is the presence of lipopolysaccharide (LPS) from bacteria in the blood.…

A: Septic shock has high modidity and mortality rate due to its effect on circulation in the body which…

Q: Since COVID19 RNA is able to replicate exponentially in human cells without being detected…

A: Covid is a disease caused by corona virus.  This is a epidemiological disease.

Q: Explain how Frederick Griffith's experiment discovered the transforming principle.

A: The bacteria from the III-S strain were destroyed by heat, and the rest were combined with bacteria…

Q: If you have to choose the most obvious/important factor for a dominant transmission (between the…

A: The traits like dominant or recessive determine the inheritance patterns. These traits help in…

Q: The types of host species a particular virus can infect are referred to as its (a) assembly (b)…

A: Viruses are simple, noncellular infectious microorganisms with DNA or RNA surrounded by the coat…

Q: Prions (a) consist of RNA with no protein coat (b) are misfolded proteins (c) cause several…

A: A prion is described as a type of protein that has the ability to trigger the normal proteins that…

Q: Hello! What are the two drugs that have potential for treating Alzheimer’s diseases? And compare…

A: Answer :- The two drugs that have potential for treating Alzheimer’s diseases are :-  -…

Q: You are treating a young boy (age 12) who has been experiences severe episodes of hypoglycemia.…

A: hypoglycemia is a condition in which your blood sugar (glucose) level is lower than normal. Glucose…

Q: 1. Briefly describe the affect of the glutamic acid to valine mutation on the Hemoglobin protein as…

A: Answer

Q: 3. In radishes, flower color may be red, purple or white. The edible portion of the radish may be…

A:

Osmosis

In simple words, osmosis is the slow, gradual movement of a liquid through a membrane. But there are nuances to this process. For instance, there has to be an imbalance in the distribution of solute in the liquid on either side of the membrane, which has to be semipermeable. The liquid in the region with a lower solute concentration moves to the region with a higher concentration, thereby displacing the solution in the process. The objective is to equalize the concentration of molecules on both sides of the membrane; the displacement of liquid can be viewed as a byproduct of this equalization. Since there is no energy required to carry osmosis, it is considered a passive process.