Diagram to compare & contrast CATABOLISM vs ANABOLISM such as its process/mechanism, relation with ATP, reaction type, etc. Moreover, provide at least two (2) specific metabolic pathways as examples for each. You can use coloring pens, crayons, and the like to make your presentation look appealing. Digital drawings are also acceptable
Q: Describe the basic chemical requirements for the aminoglycosides. Why are these compounds strongly…
A: A base can accept the protons from the solution and can exist as a cation. An acid can donate its…
Q: uan used the ABO blood testing kit to determine his blood type. His test showed the following…
A: ABO blood grouping in humans: The RBCs of the one with blood group A have antigen A and the plasma…
Q: Create your own timeline form on biochemistry development and its discovery until today
A: Introduction: The study of the molecular basis of life or understanding the life phenomenon in…
Q: 1. How is PKD inherited? What gene is responsible for the expression of PK enzyme ?
A: Pyruvate kinase deficiency is an inherited lack of the pyruvate kinase, that gets used by red blood…
Q: Where would the catalase enzyme perform best- in the human blood stream OR in the human stomach?…
A: Catalase is common enzyme found in all aerobics and it convert reactive oxygen species H2O2…
Q: Cell membranes are composed of a lipid bilayer. How does the type of lipid bilayer affect its…
A: The cell membrane is composed of a phospholipid bilayer.
Q: - RNA can take part in eukaryotic intron splicing but DNA cannot. Describe in technical detail why…
A: Splicing is a process of removal of non-coding (introns) regions from the gene. Incase of…
Q: Question 5 CH3(CH2)14–Ċ-0–CH2-(CH2)28-CH3 Palmitic acid Triacontanol
A: Lipids are a class of biomolecules that are mostly dissolved in organic solvent and contains a…
Q: In Metabolic Pathways, what are the nucleotide-containing compounds?
A: A nucleotide mainly consists of a sugar molecule that is either ribose in RNA or deoxyribose in DNA…
Q: 3. A 2-year-old child was taken to the hospital. His mother said that he vomited frequently,…
A: Mutations in enzymes of the metabolic pathways are called inborn errors in metabolism.
Q: An RNA produced from a fragment of DNA has the sequence of 5'AAUUGGCU3'. The sequence of the…
A: Genetic information in our body is stored as DNA. DNA multiples itself by replication. DNA is used…
Q: Which of the following is a fatty acid with this notation, 16:0 Stearic acid Myristic…
A: Fatty acids are important micromolecules which combine together to form lipids in plants, animals…
Q: 2. An MRNA has a sequence AAAUUACUCGAAAUUGCGUGUAGUS'. DNA, t-RNA and amino acid sequence of the…
A: Given mRNA from 5' to 3' direction: UGAUGUGCGUUAAAGCUCAUUAAA
Q: (continued) B. From a metabolic engineering perspective, why did the researchers heterologously…
A: Zymomonas mobilis is a gram negative facultative anaerobic bacteria. It ferments the pyruvate into…
Q: Only one of the statements below is correct; which one? O Two solutions are hypotonic when they have…
A: Tonicity is a parameter of the effective osmotic pressure gradient, which is the difference in water…
Q: Match the following descriptions to the given choices.…
A: A lipid is a biomolecules which include fats, waxes, oils, hormones, and certain components of…
Q: Estimate the charge on albumin in blood (pH 7.4). The sequence composition of albumin iş listed…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: In which of the following processes is glucose 6-phosphate the end product? Group of answer…
A: Glucose : Carbohydrate that serves as the major energy source for the body. Glucose-6-phosphate:…
Q: In plants, under what solution conditions are Calvin cycle and gluconeogenesis enzymes most active?…
A: Gluconeogenesis is the process of Synthesis of glucose from non Carbohydrate sources like aminoacids…
Q: Which statement about gluconeogenesis is FALSE? Group of answer choices For starting materials, it…
A: Gluconeogenesis is the biochemical pathway by which pyruvate is converted into glucose.
Q: Genetically modifying seeds to produce herbicide-resistant plants that increase crop yields has…
A: A Genetically modified technology is formed of insertion of a DNA into the genome of an organism.…
Q: 4. Liver alcohol dehydrogenase (LADH) catalyzes a reversible, pH-dependent oxidation of an alcohol…
A: Density=massvolumeDensity of methanol=mass of methanolvolume of methanol0.79 g/ml=mass of…
Q: I. Identify the reactants, enzymes, cofactors/coenzymes and products involved in the glycolysis…
A: The breakdown of glucose to obtain energy is the routine pathway of cells for fulfilling their…
Q: 6. The synthesis of fatty acids depends on the sequential transfer of three carbon malonyl-groups…
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: tochondria are considered powernou: eukaryotiC celis because they prd |cell can subsequentiy use as…
A: ATP are the energy currency of the cell. ATP helps the cell to sustain different activities. We…
Q: All of the following are standard tests used in diagnosing diabetes EXCEPT O Glycated hemoglobin…
A: Diabetics is disease in which blood glucose level in increase more than 126mg/dL.In diabetics…
Q: What is unique about the use of viral gene therapy in cancer immunotherapy
A: Virus have natural ability of delivering genetic material into the cells. Therefore, some of the…
Q: Which statement best describes the Cori cycle? Group of answer choices It regenerates glucose from…
A: Cori cycle: This is the metabolic pathway in which lactate produced during anaerobic glycolysis is…
Q: A protein sample of unknown concentration was placed in a cuvette with a path length of 1 cm and the…
A: The concentration of a protein is directly proportional to the amount of light it absorbs. The…
Q: Identify the 4 steps of gluconeoegenesis that are different from glycoslysis. Write the reactants,…
A: Gluconeogenesis (GNG) is a metabolic pathway that results in the generation of glucose from certain…
Q: O antigen is a base oligosaccharide that is present in both A and B antigen. O True O False
A: The four blood types found in humans are A, B, AB, and O. Before undergoing a blood transfusion,…
Q: 5. Convert each of the following 3' to 5' DNA sequences to 5' to 3' DNA sequences. a. 3' ATCG 5' b.…
A: DNA contains all the genetic information of an organism in the form of genes. These genes are…
Q: ANSWER BRIEFLY EACH QUESTION 1. Why is confirmatory test important to perform in different drug of…
A: The question talks about different substance abuse compounds. Right after the screening of drugs the…
Q: Question 4 Match the each enzyme deficiency with their corresponding disease B-hexosaminidase A A.…
A: Enzyme deficiency results in certain metabolic disorders and results in serious diseases.
Q: Question 20 он NH но HO" "он cerebroside monoglycosyl ceramide glycosphingolipid O all are correct
A: Phospholipids are compound lipids composed of fatty acids, alcohol, and an additional group. Based…
Q: A newly developed qPCR has an efficiency of 75%, and each cycle is pretty consistent. In this qPCR,…
A: In general, qPCR is beneficial for determining the actual value of a PCR product present at a given…
Q: Given Sorbitol, Briefly explain its expected reaction (based on their structural formula) to the…
A: Molisch's test is the specific test for Carbohydrates which give purple colour ring on addition of…
Q: Which pair of bases is linked together by two hydrogen bonds? Group of answer choices guanine and…
A: Purines pairs with pyrimidines via formation of H-bonds. Purine: Adenine, Guanine Pyrimidine:…
Q: When specific conditions are met, the creation of peptide bonds rather than the hydrolysis of…
A: Proteins are unbranched polymers constructed from 20 standard α-amino acids. They have four levels…
Q: The steps of glycolysis between glyceraldehyde 3-phosphate and 3-phosphoglycerate do NOT involve:…
A: Glycolysis is defined as the process of breaking down the compound called "glucose" to create…
Q: Only one of the statements below is correct; which one? Two solutions are hypotonic when they have…
A: Here, four statements are given based on osmotic pressure and we have to find out the correct…
Q: The process of protein decomposition by pepsin enzymes in stomach is assumed and modeled as a batch…
A: The reaction kinetics given in the pepsin digestion reaction follows Michaelis-Menten Kinetics. The…
Q: The reaction catalyzed by glyceraldehyde 3-phosphate dehydrogenase involves two "sub-reactions", one…
A: A mole of NAD is reduced to NADH by glyceraldehyde phosphate dehydrogenase, resulting in…
Q: Review method used to increase the solubility of a drug under the following headings co solvents PH…
A: Bioavailability is a powerful determinant of drug absorption. It represents the administered dose…
Q: Question 4 Match the following descriptions to the given choices v Synthesized from a steroid…
A: A vitamin is an organic molecule which is an essential micronutrient for organism and are needed…
Q: Which types of ion exchange resin will the the peptide Ala-Glu-lle-Lys- Leu-Asp-Gly bind to at the…
A: Ion exchange chromatography consists of column with loaded resin that can exchange oppositely…
Q: 3. Based on the name of the following hypothetical drug salts, which of the following statements is…
A: The given options of hypothetical drug can be described as below in terms of acid and base:…
Q: if they are true or false? Kindly leave a short explanation. Many thanks! 1. Unlike carbohydrates…
A: A biomolecule, also known as a biological molecule, is one of the many compounds created by cells…
Q: 9. Which of the following statements about trypsin, chymotrypsin, and elastase are true? A. They are…
A: Trypsin, Chymotrypsin and Elastase all three are protein digesting enzyme which uses its active site…
Q: Design a concept map on microbial growth that would contain the key features of the following…
A: Controlling microbial growth is essential in many practical situations, and research in this area of…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps with 1 images
- How Do Vitamin-Derived Coenzymes Aid Metabolism? What chemical functionality is provided to enzyme reactions by pyridoxal phosphate (we Chapter 13)? By coenzyme A (see Chapter I9)? By vitamin B12 (see Chapter 23)? By thiamine pyrophosphate (see Chapter 19)?Give the Steps, Enzyme/s involved, Electron carriers, ATP Generation, End product and significance of the following metabolic pathway: Oxidative Phosphorylation (explain in 1-3 sentences only) P.S add row if necessaryDEFINE THE FOLLOWING TERMS: a) Metabolism b) Catabolism c) Anabolism Please explain this in-detailed and longer, thank you.
- Give the Steps, Enzyme/s involved, Electron carriers, ATP Generation, End product and significance of the following metabolic pathway: Lipid Metabolism (explain in 1-3 sentences only) P.S add row if necessaryThe mechanism of chymotrypsin is used as a model for studying enzyme reaction mechanisms. Answer the following questions related to chymotrypsin: 1. List the 3 amino acids in the catalytic triad of chymotrypsin. 2. List the types of catalytic mechanisms (from the 3 main types of catalytic mechanisms) displayed in the mechanism of chymotrypsin.Please help me identify these based on the model on the picture (even without explanation), thank you so much!1. What is metabolism? 2. What are the two types of metabolism? 3. Which metabolic reaction requires an input of energy? 4. Which metabolic reaction releases energy? 5. Which reaction yields a more complex molecule and is reductive? 6. Which reaction yields a simpler molecule and is oxidative? 7. What are the products of catabolism? Which part of the cell does this pathway take place? 8. What are the products of anabolism? Which part of the cell does this pathway take place? 9. Which reaction is divergent? Why? 10. Which reaction is convergent? Why? 11. How can you relate waterfalls to a mole of glucose? 12. What are the steps in catabolism? 13. What is the common pathway of the degraded complex molecules?
- Give the Enzyme/s involved, Electron carriers, ATP Generation, End product and significance of the following metabolic pathway: Glycolysis (explain in 1-3 sentences only)Briefly outline the electron flow in oxidative phosphorylation to describe how its function is directly coupled to ATP synthesis. Be sure to include where the electrons that feed into oxidative phosphorylation come from in your answer.DRAW IT Using a series of arrows, draw the branched metabolicreaction pathway described by the following statements, andthen answer the question at the end. Use red arrows and minussigns to indicate inhibition.L can form either M or N.M can form O.O can form either P or R.P can form Q.R can form S.O inhibits the reaction of L to form M.Q inhibits the reaction of O to form P.S inhibits the reaction of O to form R.Which reaction would prevail if both Q and S were present inthe cell in high concentrations?(A) L S M(B) M S O(C) L S N(D) O S P
- Explain the “coupling” effect of ATP on catabolism and anabolism (please use the image for reference. thanbk you)Explain briefly (in less than 100 words) how ATP synthase works. Show and explain the structure and function of and the difference between the two protein domains (Fo and F1) of the enzyme.Beside each compound listed, indicate what stage or stages of cellular respiration it is associated with by placing an 'X' in each applicable box. Compound Glycolysis Pyruvate Oxidation Kreb's Cycle ETC/Chemiosmosis a. ATP b. Acetyl-CoA c. Citric Acid d. Coenzyme A e. Glucose f. Pyruvate g. FADH2 h. ATP synthase i. CO2 j. H2O k. O2