O antigen is a base oligosaccharide that is present in both A and B antigen. O True O False
Q: a reasonable biosynthesis for Compound 14 starting from Propose alanine, S-phenylalanine and ATP.
A: Given compound in a figure is Aspartame. Aspartame is a non-saccharide artificial sweetener that is…
Q: Propose a reasonable biosynthesis for Compound 14. MUST BE in this order: Acetyl CoA SAM S-alanine…
A: Here compound 14 is synthesized from L-Phenylalanine, SAM, L-alanine, and Acetyl-CoA in multistep…
Q: Iculate the actual, physiological deltaG for the reaction Phosphocreatine + ADP > creatine + ATP at…
A: Disclaimer: Since you have asked multiple question, we will solve the first question for you. If you…
Q: Which of the following statements are FALSE? Multiple answers:Multiple answers are accepted for…
A: Which of the following statements are FALSE? Multiple answers:Multiple answers are…
Q: 4. Complete the table below: RNA DNA Strand Sugar residue Nitrogenous bases Main Function
A: Nucleic acids are made up of nucleotides, which are the fundamental building blocks of DNA and RNA.…
Q: Break down this fatty acid. Show all the products made and the enzymes needed for any non-normal ß…
A: Fatty acids are building blocks of fats and composed of carboxylic acid with long aliphatic chain.…
Q: What is the Keq for the conversion of Glucose 6-Phosphate to Glucose 1-Phosphate if the phosphate…
A: Given- 1) Potential for Glucose 1-phsophate.- 20.9KJ/mol 2) potential for Glucose 6-Phosphate-…
Q: Eukaryotic polymerases have the same number of subunits as prokaryotic ones. True False
A: The process of creating an RNA copy of a gene sequence is known as transcription. The copy is known…
Q: Identify the ff nucleic acid bases and then classify whether it is a purine or pyrimidine.
A: Nucleic acids are also known as polynucleotides. Monomeric units of nucleic acids are called…
Q: When mixes with benedict's solution test tube A 4 amylase and starch will have what color and why
A: Amylase is an enzyme that helps to digest food. Most of our amylase is made in the pancreas and…
Q: One of the major problems in food chemistry is to make food gels maintain its shape and rigidity.…
A: Carrageenan are polysaccharides comprised of repeating disaccharide units of sulfate derivatives of…
Q: Arrange signalling cascade events in chronological order.…
A: Signaling pathways helps to respond the cells according to the external stimuli. The external…
Q: What part of the electron transport chain is responsible for the greatest contribution to oxidative…
A: Protein complexes are present in the inner membrane of mitochondria forming an electron transport…
Q: 8. In the Stomach: a. Is there digestion? YES or NO b. If YES, then answer i-iv to explain. If NO,…
A: Fats are esters of fatty acids , also called as lipids/triglycerides.
Q: There are two types of nucleic acids-DNA and RNA, both are composed of nucleotide subunits. Complete…
A: The nucleic acid polymer has nucleotide as its monomeric unit. synthesis of nucleotides is…
Q: ACTIVITY 7.2.2 Show and explain how exactly the condensation reaction to form a nucleotide happens.…
A: Nucleotides are the phosphoric acid esters of nucleosides with the phosphate group. Nucleotides are…
Q: Classify each protein as fibrous or globular. A. albumin B. myosin C. fibroin
A: Globular proteins are characterized by having globin like fold. Globin heme bonding protein with…
Q: 1) What is the chemical group at the end of the R groups of basic amino acids that makes them…
A: There are twenty standard amino acids that make up all of the proteins. The twenty standard amino…
Q: Which of the following is a drawback of using base hydrolysis during amino acid composition? A.…
A: The amino acids that occur naturally as constituents of proteins have an amino group (NH2) and a…
Q: 7. Which of the following statement is true? A. oxidative rancidity is observed more frequently in…
A: Introduction: Rancidity is the development of unpleasant smells in fats and oils that is often…
Q: 2. Calculate the overall charge (pH 7) on the following three polypeptides and answer the questions…
A: Hi! Thank you for the question. We are authorized to answer three subparts at a time, since you have…
Q: Which of the following is the CORRECT relationship?
A: Phosphatidylinositol 4, 5 bisphosphate is known as PIP2 that is a component of cell membrane -…
Q: What are the different types of RNA? Where are these types located within the cell?
A: Introduction: The structure of RNA is made up of a repeating strand of nucleotides that contain all…
Q: Draw the structure (using chair confirmation of pyranose) of the following disaccharides. (a)…
A: Disaccharides are carbohydrates that, when hydrolyzed with acids or enzymes, provide two…
Q: 10. The degree of unsaturation of lipid can be measured as A. saponification number B. iodine number…
A: Saturated fats are the fatty acids in which the hydrocarbon chain with a carboxyl group contains…
Q: least likely affected by changes
A: The three-dimensional arrangement of atoms in an amino acid-chain molecule is known as protein…
Q: 25. What would be the new pH of a 1L buffer solution (pH=7.8) upon the addition of 3mL O.0001 M HCI.…
A: The new pH of a 1L buffer solution (pH=7.8) upon the addition of 3mL 0.0001 M HCI. (Buffer, pka=7.2)…
Q: When can we say that it is an essential amino acids and non essential amino acid? Choose two amino…
A: Introduction: Amino acids are biomolecules that contain an amino and a carboxyl group-containing a…
Q: state the form in which the energy is present in the carbonhydrate eaten by the ox
A: Carbohydrates, abbreviated as carbs, are sugar molecules. Carbohydrates are one of three major…
Q: The term rRNA refers to ______ RNA.
A: Ribosomal RNA is abbreviated as rRNA.
Q: Design the simple process scheme diagram for (fermentation and recovery of glutamic acid from palm…
A: The breakdown of carbohydrate under anaerobic condition is referred to as fermentation. In…
Q: *Which of the following statements about allosteric enzymes is NOT true? Question 10 options: - They…
A: Ezymes are boost up chemical reaction in body.allosteirc enzyme are type of Ezymes.Allosteric enzyme…
Q: Both choices B and D are correct.
A: Cholic acid which is also called as 3α,7α,12α-trihydroxy-5β-cholan-24-oic acid and represents as a…
Q: TRUE OR FALSE: 1. The 35S precursor is the precursor RNA transcript for all ribosomal RNAs except…
A: Ribosomal RNA is the component of Ribosomes which is essential for translation and forcing tRNA and…
Q: Which of the following statements is TRUE for nonpolar amino acid residues of polypeptides or…
A: They are hydrophilic and found buried within proteins FALSE. Water soluble proteins contain…
Q: What glycolytic intermediate does glycogenolysis produce? Explain in brief..
A: Glycolysis is a metabolic pathway in which glucose is converted to pyruvate. The principal sugars…
Q: Which of the following chromatographic techniques allows a faster elution of polar proteins? O…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: What are nucleic acids?
A: Carbohydrates, proteins, lipids, and nucleic acids are the four biomolecules, which are essential…
Q: a. What is isoelectric point? (Round your answer to two decimal places, for example: 0.13 or 1.45 or…
A: The isoelectric point (pI) is the pH at which a particular molecule carries no net electrical…
Q: Using linear regression analysis, determine the values of Vmax and Km of the enzyme in the ab- sence…
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: 1. What is the physiologic function of pigments in plants?
A: Pigments are compounds that absorb specific wavelengths and reflect away, the other. Plant parts are…
Q: In a paragraph format How amylase is used/its purpose and why amylase useful in the food industry
A: Any enzyme that catalyses the hydrolysis (breaking of a substance by the addition of a water…
Q: How amylase is used/its purpose and why amylase useful in the food industry
A: Amylase are the Enzymes that can digest starch into small polymers of glucose units. They can…
Q: Enzymes
A: enzyme, a molecule that works as a catalyst in living organisms, controlling the pace at which…
Q: I. True or False a. The beta-pleated sheets are formed by H-bonds among adjacent regions of the…
A: A. FALSE - The beta-pleated sheets are formed by H-bonds between neighbouring strands.
Q: Why does it make sense that under conditions of low ATP levels in the cell the pyruvate carboxylase…
A: Pyruvate carboxylase (PC) is a ligase class enzyme which catalyze the irreversible carboxylation of…
Q: 29. Here is a strand of DNA: TACCCGGTATAACGCTGGAAAGCTTAAGCAACATCGCCCGACCCC AAATCT…
A: DNA strand given here with directionality is as: 5’…
Q: does HEW have a higher concentration of negatively/neutral charged protein (at ph 7) explain ur…
A: HEW ( hen egg white) is an enzyme specifically known for its ability to degrade the polysaccharide…
Q: a deaminating agent 5-BU is that can base-pair ike cytosine or like if 5-BU is cytosine incorporated…
A: 5-Bromo Uracil and nitrous acid are mutagenic agents. It means both of these agents cause mutation…
Q: (Part A) Coenzyme-dependent enzymes can catalyze the general transformations shown below. What would…
A: The process of translation takes place in the cytoplasm which converts mRNA to…
Step by step
Solved in 3 steps
- GGU ACG UUG GGG CUC CAU or CCA UGC AAC CGG GAG GUA doesn't work look for the answerQuestion 13 Additional precautions (in addition to routine practices) should be used when treating adult clients infected with: Question 13 options: a) Streptococcus pneumoniae b) West Nile Virus c) Influenza A d) Chlamydia trachomatisQuestion 69 The presence of Gram-negative diplococci in pus collected from an inflamed penis is diagnostic for infection by: Question 69 options: a) Chlamydia trachomatis b) Neisseria gonorrhoeae c) Human herpesvirus 2 d) Treponema pallidum
- Question: 16. Overfilling a culture bottle that will be used in an automated system where bacterial growth is assessed by monitoring CD, levels can lead to a. false-negative results b. false-positive results 17. The optimal volume for blood-culture collection on adults is a. 20 mL of blood per bottle b. precisely 10 mL of blood in each of two bottles c. 20 mL of blood distributed betvveen two bottles but not exceeding 12 mL per vial d. dependent upon the patient's body weightQuestion 2 The Kirby-Bauer disk diffusion method is often used in clinical diagnostic labs. Question 2 options: a) True b) FalseAnswer is not II
- They said we must answer the following questionQuestion 79 The discovery of antibodies and the understanding of their actions directly resulted in: Question 79 options: a) The development of passive immunization b) Improved vaccine design c) Improved methods of immunization d) The development of genetically engineered vaccinesThe selected answer is incorrect