Describe the basic chemical requirements for the aminoglycosides. Why are these compounds strongly basic and exist as polycations at physiological pH? (Use equations to explain). OH OH HỌ H2N- HO HO. Но HO NH2 H2N NH2

Describe the basic chemical requirements for the aminoglycosides. Why are these compounds strongly basic and exist as polycations at physiological pH? (Use equations to explain). OH OH HỌ H2N- HO HO. Но HO NH2 H2N NH2

Biology: The Unity and Diversity of Life (MindTap Course List)

14th Edition

ISBN:9781305073951

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter3: Molecules Of Life

Section: Chapter Questions

Problem 3SQ: _______ groups are the acid part of amino acids and fatty acids. a. Hydroxyl (OH) b. Carboxyl (COOH)...

See similar textbooks

Related questions

Q: Question 12 C17H29COOH O linolenic acid O non-saponifiable O w-3 fatty acid O All are correct

A: C17H29COOH - It has double bonds at 9, 12, 15th carbon position

Q: Assume the energy of hydrogen bonds per base pair to be 5.86 kJ-mol-1. Given two complementary…

A: Given Energy of H-Bond per base pair = 5.86 kJ mol-1 Number of Base pair in complementary DNA = 145…

Q: Calculate the actual free energy of hydrolysis of ATP, delta Gp in the erythrocytes of a new…

A: Actual free energy (∆G) is the maximum amount of energy which is available to perform work. Standard…

Q: When specific conditions are met, the creation of peptide bonds rather than the hydrolysis of…

A: Proteins are unbranched polymers constructed from 20 standard α-amino acids. They have four levels…

Q: QUESTION; — Compare and contrast the degradation pathways of purines and pyrimidines, making sure to…

A: Nucleotides are used in nucleic acid synthesis, intermediate metabolic processes, and the breakdown…

Q: Identify the ff nucleic acid bases and then classify whether it is a purine or pyrimidine.

A: Nucleic acids are also known as polynucleotides. Monomeric units of nucleic acids are called…

Q: ODD MAN OUT. Which of the following is not related to the other choices below? adenylyl cyclase…

A: Signaling is the process of communication between the cells, and between the cells and the…

Q: Draw the Fischer projection formula for each sugar and give the importance/use of each. 1. D-…

A: Note : Hi ! Thank you for the question. We are authorized to answer three subparts at a time. Since…

Q: When do plants usually undergo mitochondrial respiration?

A: Mitochondrial respiration is commonly known as cellular respiration. This is the process of energy…

Q: 1. Glucose synthesis was investigated in isolated hepatocytes. Different amino acids were added to…

A: Amino acids are building blocks of proteins which is consist of amine group, carboxylic group,…

Q: Gluconeogenesis in the liver is When blood glucose levels are low, glucagon is secreted from the…

A: Blood is defined as the type of constant circulating fluid that play a major role in carrying…

Q: A polypeptide is shown below. Please answer the following questions. OH В A C H;N E H D H a. Match…

A: A polypeptide is a long, unbranched chain of amino acids joined by peptide bonds. To generate an…

Q: What glycolytic intermediate does glycogenolysis produce? Explain in brief..

A: Glycolysis is a metabolic pathway in which glucose is converted to pyruvate. The principal sugars…

Q: Which of the following is a fatty acid with this notation, 16:0 Stearic acid Myristic…

A: Fatty acids are important micromolecules which combine together to form lipids in plants, animals…

Q: ssume that you have radioactively labeled an amino acid in a glass of milk. Also assume that you…

A: Introduction: The term digestion refers to the integration of complex nutrients into simple, soluble…

Q: Colchicine is used to treat gout. It alters cytoskeleton function. Why do you think it is useful for…

A: Gout is a frequent and complicated form of arthritis that can strike anyone at any time. It's…

Q: III. Effect of inhibitor Color of bromothymol blue indicator Test Tube Original color Final color A…

A: Bromothymol blue is a pH indicator that commonly turns yellow in acidic solution and turns blue in…

Q: Choose two amino acid and explain the metabolism.

A: Introduction: Amino acids are molecules that contain an amine and carboxylic group with side-chain…

Q: A. Lysine: Polar basic: Calcium absorption B. Proline: Nonpolar imino acid: Protein synthesis C.…

A: A. Lysine is basic, has R group that is significantly positively charged at pH 7. It has second…

Q: ceramide with a single sugar is called? Cerebroside Plasmalogen Sphingomyelin…

A: sphingolipids : found in brain extract, contain a backbone of sphingoid bases, a set of organic…

Q: 2. Glvcolate is oxidized into Glvoxylate by cytochrome Cusing the glycolate oxidase enzyme, The two…

A: Glycolate oxidase is a key enzyme involved in the conversion of glycolate to glyoxylate during…

Q: Match the following descriptions to the given choices. Enzyme involved in the conversion of…

A: The above match the following is from an important pathway involving the biosynthesis of…

Q: Which of the following glycerophospholipid has a phosphate ester attached to a sugar moiety O…

A: Phosphoglycerides or Glycerophospholipids are the main component of biological membrane, usually…

Q: 5. Convert each of the following 3' to 5' DNA sequences to 5' to 3' DNA sequences. a. 3' ATCG 5' b.…

A: DNA contains all the genetic information of an organism in the form of genes. These genes are…

Q: A solution containing 3.58 x 1023 molecules/m3 of protein in water is separated from pure water by a…

A: Introduction: According to Fick's first law, the movement of particles from high to low…

Q: 5. Amino acid methionine is used as medicine due to its lipotropic ellect («removes» fat excess from…

A: The orange structure is the liver The red arrows indicate the transport is happening via the blood…

Q: What is an enzyme and what is its function?

A: In our body, various metabolic pathways are present like Glycolysis, glucogenesis, etc. These…

Q: 29. Here is a strand of DNA: TACCCGGTATAACGCTGGAAAGCTTAAGCAACATCGCCCGACCCC AAATCT…

A: DNA strand given here with directionality is as: 5’…

Q: Match the each enzyme deficiency with their corresponding disease…

A: Different enzymes are required for synthesis of spingolipids. If these enzymes are not…

Q: succinate to phosphoenol-pyruvate

A: Pyruvate is transformed to phosphoenolpyruvate (PEP) via oxaloacetate (OA), which can be thought of…

Q: IV. Test Tube Effect of Enzyme concentration Concentration of Observations enzymes (mL) I 2 3

A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…

Q: 1. What are the three major pathways that eventually become entry points of molecules into the Krebs…

A: Hi! Thank you for the question, as per the honor code, we are allowed to answer the first…

Q: COMPLETE THE TABLE OF 10 STEP OF GLYCOLYSIS BY REFERRING TO THE GLYCOLYSIS PATHWAY

A: The chemica; interconversion steps, that is the sequence of reaction by which glucose is converted…

Q: The following statements are TRUE regarding carbohydrates, EXCEPT: Carbohydrates are the most…

A: Introduction: Carbohydrates are polyhydroxy aldehydes or polyhydroxy ketones with a general formula…

Q: Which of the following has the strongest tendency to gain electrons? Select one: O a. FAD O b.…

A: The electrons released from NADH and FADH2 are transferred to molecular oxygen in ETC to generate a…

Q: Increased levels of NADH in the liver promote the process of gluconeogenesis. What do you make of…

A: Introduction: The process of synthesis of glucose or glycogen from non-carbohydrate sources in the…

Q: Which of the following refers to the test performed 2 hours after an overnight-fasted patient was…

A: Different tests are used to test the blood glucose level.

Q: What are the description of the ff? A. Enzyme influence on reaction velocity B. Effect of…

A: Enzymes are biological catalysts (also called biocatalysts) that accelerate biochemical reactions in…

Q: Derivatives of purines and pyrimidines make up the base component of nucleotides. Select the…

A: Purines and pyrimidines are nitrogenous bases that makeup two types of nucleotide bases in DNA and…

Q: 7. Which of the following statement is true? A. oxidative rancidity is observed more frequently in…

A: Introduction: Rancidity is the development of unpleasant smells in fats and oils that is often…

Q: 1. Explain the difference between Toxicokinetics and Pharmacokinetics. 2. How is Absorption,…

A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…

Q: 1. Why a peptide bond can't rotate freely? 6%. 2. The and are two amino acids usually will break an…

A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…

Q: Sort the electron acceptors that are able to diffuse inside the mitochondrial matrix from those that…

A: Protein complexes are present in the inner membrane of mitochondria forming an electron transport…

Q: In the Haworth projection for Glucose the hydroxyl on carbon 1 is shown projected up or down. b In…

A: As you have asked multiple sub part questions we are supposed to answer only first 3 subparts for…

Q: The herbicide glyphosate (Roundup®) kills plants. Discuss all the Biochemistry involved as to why…

A: Herbicides are the chemicals used to kill unwanted species of plants growing around the…

Q: I. Identify the reactants, enzymes, cofactors/coenzymes and products involved in the glycolysis…

A: The breakdown of glucose to obtain energy is the routine pathway of cells for fulfilling their…

Q: 5' 3' For numbers 6 to 10, refer to the image above and answer the questions. 9. How are Okazaki…

A: Okazaki fragments : These are pieces of DNA which are the transient components of the lagging strand…

Q: 4. The sequence of a peptide A formed by 16 amino acids was determined using a combination of…

A: Proteins are chain of amino acids linked by peptide bond with release of a water molecule. Alpha…

Q: What are examples of enzymes?

A: Enzymes are nothing but Proteins that help us in our metabolic pathways to increase the rate of…

Q: Now let us look at a real amino acid, alanine. Fill in the chart below for each ionizable group. You…

A: Amino acids are the building block of proteins. Amino acids are consisted of carboxyl group, amine…

Question

2. Describe the basic chemical requirements for the aminoglycosides. Why are these compounds
strongly basic and exist as polycations at physiological pH? (Use equations to explain).
OH
OH
HO
H2N-
Но
HO.
Но
HO
NH2
H2N-
NH,

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

4. What is the role of decarboxylation in fatty acid synthesis? Describe another process discussed in this Biochemistry I course that uses decarboxylation for the same purpose.
Amino acids with non-polar side chains are zwitterions at a. middle pH levels, between the pKa’s of the amino and carboxyl groups. b. very low pH, where the hydrogen ion concentration is high. c. none of the above. d. the pKa of the side chain.
1. Which of these disaccharides are 'reducing'?
1. What makes monosaccharides and disaccharides completely soluble in water? Why are polysaccharides not as soluble?
1. Explain the processes involved in the tracking down of fatty acid in metabolism (e.g. palmitic acid) after ingestion 2. Give examples of fats or lipid molecules with their biological and/or physiological importance.
1. What is the common metabolic pathway of carbohydrate, protein and lipids? Explain the process involved.
1. What are the differences between unsaturated and saturated fatty acids? 2. What is Biological Value (protein)? 3. What is Chemical Score (protein)? 4. What temperature is your beverage optimal for rehydration?
1. Draw NEW amino acids; name them and characterize them, following the rules and properties of the 20 existing, essential amino acids 2. Make two dipeptides with your two new amino acids. Name the two dipeptides. Indicate the peptide bond.
AMINO ACIDS 1. Write the tripeptide structure for: val-ser-cys. 2. Write the reactions for: phe + ser
1. What role do eicosanoids play in the body? What is the primary fatty acid in their composition? 2. What purpose does inflammation serve? What are some of the symptoms of inflammation?
1. What reactive groups are involved in the joining of glycerol and fatty acids?2. Which one of these reactive groups is part of the glycerol molecule?3. Which one of these reactive groups is part of the fatty acid molecule?
1. What biological molecule are required in the synthesis of protein( choose all that apply)? - phosphate ester - fatty acid (s) - alcohol - glycerol - amino acids 2. ATP is generated during A. Aldehyde reduction B. Alkene hydration C. Acetal synthesis D. Polysaccharide hydrolysis 3. What compound( biological classification) would be the result of protein complete hydrolysis in the mouth? A. Fatty acid and glycerol B. Monosaccharides C. Amino acids D. Disaccharide 4. The hydrophobic/ hydrophilic interaction are present in which protein structure level (s) (choose all that apply) ? - secondary - primary - tertiary -quaternary 5. Which protein structural level is/ are affected by the addition of an organic solvent isopropanol? A. Secondary B. Tertiary C. All are affected D. Quaternary