Discuss the 4 components of Medicare. Where are these 4 components applicable and why is it important to know this information?

Q: multicellular organisms, nondividing cells stay in G0 phase. For the cell, why is it better to be he...

A: Cells first enter into the G0 phase from a cell cycle checkpoint then in the G1 phase, there are som...

Q: Discuss the benefits and risks of three prenatal diagnosismethods

A: Prenatal diagnosis is referred as a set of procedures run before the delivery of the child. It is do...

Q: Which among the processes below will be used during heat defense? vasodilation and thermogenesis O s...

A: vasodilation work against heat as sweating does  When heat produce in body to balance the body tempe...

Q: Which of the following is a type of gene transfer that is NOT species-specific? O conjugation O tran...

A: Answer 5:- Transduction is a process in which the virus transfers genetic material to the cell. Here...

Q: Marfan syndrome (Section 13.5) is inherited in an autosomal dominant pattern. What is the chance tha...

A: Introduction:- Marfan syndrome is a connective tissue disorder caused by a genetic mutation. Mutatio...

Q: The two basic requirements, needed for studying the type of protein synthesis and intercompartmental...

A: Palade and colleagues' study detected the location of newly synthesized amino acids by labeling them...

Q: Please help me answer how much volume of cell suspension needed (for 5*10^4 cells) in microliters. P...

A: For some experiments, it is essential to use the specified number of cells of microbes (or otherwise...

Q: 5

A: Recombinant forms of Oestrogen and Progesterone are used in post menopausal women. Recombinant insul...

Q: in your own words,  please describe the squash and the squash soup

A: Squash:- Squash is a kind of vegetable in a family of plants that comes in several different types, ...

Q: Outline the flow of genetic information in cells, from DNA to RNA to polypeptide.

A: DNA is the genetic material present in the cells.  

Q: Evolution______ . a. is change in a line of descent b. is the same as natural selection c. is the go...

A: Different patterns are associated with evolution and such patterns help in categorizing evolution in...

Q: Match the sense orgs with the type of stinulus they are able to detect Ooo mouth (Choose) ight chemi...

A: Stimulus(plural)/Stimuli(Singular) Any change in an organism's environment that causes to the organi...

Q: Primer designing: A single-stranded DNA sequence (963 nucleotides) that codes for a hypothetical pro...

A: ANSWER;-  Forward primer:Sequence = 5'-CT-GAATTC-ATGGCTAAAGGCGGAGCT-3'Length = 18 ntdGC content = 56...

Q: Based on the information above, what can you speculate about the possible evolution of the genes tha...

A: Rab proteins are small GTP-binding proteins within a superfamily of GTPases known as the Ras superfa...

Q: NAD+ b. Pyruvate

A: Fermentation is a well stated to been supposed to define as is a metabolic process that involves the...

Q: List the four main types of organic compounds found in living systems, and identify which of these a...

A: All the living organisms are made up of cells and each and every cell of the body is made up by a or...

Q: How does the vegetal stratification of an ecosystem influence its biological diversity?

A:     Stratification in the field of ecology refers to the vertical layering of habitat. The arrangeme...

Q: Density independent or Density dependent Situation Limiting factor 4. Super typhoon Yolanda caused m...

A: Biological population can be controlled by biological factors or by the the physical or or chemical ...

Q: A set of cells that host various DNA fragments collectively representing an organism’s entire set of...

A: DNA molecules are present in the cells of living beings and regulate the genetic traits.

Q: (a)Describe the small intestine epithelia cells observed under HPO in microscope. (b) Describe the k...

A: In small intestine mainly simple columnar epithelium and in kidney simple cuboidal epithelium is fou...

Q: Compare the structures of DNA and RNA.

A: Nucleic acids are the most important organic compounds found in all living beings. The three major c...

Q: In order to view Treponema pallidum, the causative agent of syphilis, under the microscope, you can ...

A: Treponema pallidum is the causative agent of sexually transmitted disease (STD) called syphilis. 

Q: a) Provide a description of the the small intestine epithelial cells observed under high power objec...

A: Histopathology:- Small Intestine Mucosa: - Type of Lining: - Simple Columnar Epithelium Morphology:-...

Q: 2. Draw a Punnett square of a cross between a homozygous dominant individual and a heterozygous indi...

A: Answer 1: -  Parent individuals: - BB (homozygous dominant), Bb(heterozygous dominant) Cross: -  ...

Q: Dinosaurs like protoceratops how do they defend themselves from predators like velociraptors or othe...

A: Dinosaurs like protoceratops how do they defend themselves from predators like velociraptors or othe...

Q: expalin how theory of evolution affects our view of the origin, developtment and spread of new disea...

A: The theory of evolution is based on the idea that all species are linked and evolve through time. Th...

Q: Test 6- Comparing the DNA (Gene) Code for Dopamine Active Transport Protein Once dopamine triggers a...

A:   Here,  human DATP gene sequence of human is given , i.e :  ATTCCGGATCGATATCGCCGGATATACTCCGGTAATATC

Q: How are enzymes classified? What are the different classes of enzymes?

A: Enzymes are biocatalyst that is proteinaceous in nature and perform a specific type of chemical reac...

Q: are venules blood reservoirs ?

A: At any resting point of time, Venous System is said to occupy 70% of the total circulating blood vol...

Q: A.If the diploid human chromosome number (2n) =46, what will be the chromosome number per cell in ea...

A: Meiosis is the cell division process that involves division of a diploid (2n) mother cell and produc...

Q: Describe the various post-translational modifications of HIF- 1alpha and how it affects the regulati...

A: Describe the various post-translational modifications of HIF- 1alpha and how it affects the regulati...

Q: Domestic cats and dogs and other domesticated animals have they shown any signs of evidence of evolu...

A: Domestication is an evolved trait in which animals are selectively bred and experience significant m...

Q: What would be affected if the globular head of myosin was misshapen? a) The ability to bind to acti...

A: Myosin is a protein, but specifically, a motor protein and a fibrous globulin of muscle that can spl...

Q: An individual’s unique set of_______ can be used in DNA profiling. a. DNA sequences c. SNPs b. short...

A: Introduction  In the genome, there is usually two types of nucleic acid sequence present. One is Non...

Q: 8. Another unique feature of coronaviruses is usage of a -1 ribosomal frameshift. Explain this frame...

A: Defination- Ribosomal frameshifting is a biological phenomenon that occurs during translation that r...

Q: Hello, good day. I have a problem answering this question, and I need your help. Hoping for a respon...

A: Physical features of Aedes aegyptiAedes aegypti is a small, dark mosquito that mosquitoes are distin...

Q: Question:  How has having an opossable time thumb helped primates, especially humans to adapt to th...

A: Having an opossable time thumb helped  humans especially to adapt to their environment and better su...

Q: A molecule of composition5′-AAAAAAAAAAA-3′3′-TTTTTTTTTTTTT-5′is replicated in a solution containing ...

A: Atoms with unstable nuclei regain what is supposed to describe as they are about to define stability...

Q: H* ions generated by reactions in the electron transport chain, as well as H* ions present in the ma...

A: The electron transport chain is a series of reaction in  four protein complexes, taht creating an el...

Q: During which decade were there the most contributions leading to the understanding of DNA?

A: Rosalind Franklin made an essential commitment to the revelation of the twofold helix design of DNA,...

Q: What goes into the reaction tube for Sanger sequencing?   Template DNA, primers, DNA polymerase, an...

A: Sanger sequencing was developed by  Frederick Sanger and his colleagues in the year 1977 to determin...

Q: Give the similarities and differences of plants and animals in terms of its: Reproduction, developme...

A: There are lot of differences between plants and animals. The first and foremost difference between p...

Q: Which Class I element has likely experienced the greatest accumulation of mutations compared to its ...

A: Transposable elements are the Jumping genes which are the mobile genetic material within the genome....

Q: 3. Repeat steps I and 2 for an ear of corn that is the result of crossing Homozygous dominant and he...

A: Mendelian inheritance, or Mendelism, is a collection of hereditary notions proposed in 1865 by Grego...

Q: interaction between cells and their environment

A: Answer :- Cells incorporate signs from their outside and intracellular climate into essential cycles...

Q: Ebola virus kills 90% of the people infected. In an infected individual, how many copies of Ebola Vi...

A: The usual concentration of Ebola in patient's blood is 5-10 X 106 virus particles/ mm3. Major organs...

Q: Explain how FRET could be used to monitor the association of Gαs and adenylyl cyclase following acti...

A: How does fret, a sort of fluorescence can be utilised to essentially check Its interaction of the Ga...

Q: Question 2 KEY #100 O Normal female Normal male Carrier female Female with disorder Male with disord...

A: *A carrier male is married to a normal male and they have two children with having  One diseased ma...

Q: What are helicases and topoisomerases?

A: Enzymes are the proteins present in the cells and have catalytic powers.  

Q: What is the difference between a mesoderm and a mesoglea?

A:     Diploblastic animals contain body wall which develop from 2 embryonic germ layer - ectoderm and ...

Clinical Pharmacology

Pharmacology is a discipline of medicine that studies how medications interact with the systems and processes of living organisms, focusing on drug action mechanisms as well as therapeutic and other purposes.