Q: 2. Over many generations, the average length of necks in a giraffe population will increase…
A: Introduction Evolution refers to the change of characteristics of a population that can be inherited…
Q: Do mRNA levels increase or decrease as DNA methylation increases?
A: DNA is a molecule that is composed of two strands of polynucleotides. It stores genetic information…
Q: In mitosis, why do the chromosomes need to condense in prophase and line up in metaphase? (To be…
A: Mitosis is a process in which eukaryotic cells usually divides into two. Prokaryotes usually lacks…
Q: Describes the effect of tissue dehydration on cellular function provide citation and reference.
A: Histological processes evaluate tissue. It consists of different steps. In this process, tissues are…
Q: Is eating of dog meat good or bad? Essay
A: Food is a material that is mostly made up of nutrients such as protein, carbohydrates, and fat. It…
Q: When studying a bacteria that's neither aerobic or anaerobic. Do you expect it to be oxidase…
A: Introduction The oxidase reagent is applied to a piece of filter paper. A plastic or platinum loop…
Q: Do you believe stress is harmful to your health or part of life? Explain why or why not. Select 2…
A: The answer is YES. Stress symptoms can affect our body, our thoughts and feelings, and our behaviour…
Q: 21:14 +4G KB/S LTED 41 96 09.00 Vo Microsoft Word - Assignment 02.docx Assignment 02 1. Groups of…
A: “Since you have asked multiple question, we will solve the first question for you. If youwant any…
Q: In snapdragons, the inheritance of flower color and size of leaves are examples of Incomplete…
A: Homozygous and heterozygous are the terms that are used to describe allele pairs. *Individuals which…
Q: 1- a)Describe ONE strength and ONE limitation of Piaget's theory. b) Choose one strength of…
A: Since you have asked multiple questions, we will solve the first question for you. If you want…
Q: Growers often wrap potted plants in plastic sleeves prior to shipping. If plants remain in these…
A: Introduction : Ethylene is one of the plant growth regulators. Ethylene hormone inhibits the growth…
Q: As DNA methylation increases, mRNA levels... Oincrease Odecrease
A: DNA methylation is a process in which the methyl groups are added to the DNA.
Q: a-In a population that is in Hardy-Weinberg equilibrium, 38 % of the individuals are recessive…
A: When the evolutionary influences are not there, the net allelic and genotypic frequencies of a…
Q: Please consider Figure 8.8 (attached below) in the textbook (Figure 8.7 in the 4TH edition), which…
A: The haplotype frequency divergence from expected values based on gene frequencies, or D, is a…
Q: transcription initiation site GCAGTGACCGGATATAACGAAGAGGAATGCCGTACAAA 5' UCCUUAC 3' Which of the…
A: Coding strand is the that strand of DNA whose sequence is identical to the mRNA sequence while…
Q: Differentiate the genotype and phenotype
A: Genetics is a field of science that explains how genes ( hereditary unit)/ traits are passed from…
Q: Does the Solute inside or outside the cell?
A: Introduction When two solutions are next to one another and are divided by a semipermeable…
Q: A) A husband and wife have four daughters. What is the probability that their fifth child will also…
A: The sex of an organism allows the mixing of various genes, evolution, etc. In humans, sex is…
Q: 1. (a) Compare and contrast the cell wall in bacterial cells, fungal cells and plant cells.
A: A hard, exterior layer created expressly to offer structural strength and stiffness is referred to…
Q: 1. Match the term with the correct definition. Portion of DNA which codes for a protein, which leads…
A: DISCLAIMER FOR MULTIPART Since you have posted a question with multiple sub-parts, we will solve…
Q: Which of the following is a product of glycolysis that is transported into the mitochondria?…
A: Glycolysis is the process by which one glucose molecule is transformed into two pyruvate molecules,…
Q: 5. Set up the punnett square for each of the crosses listed below. The characteristic being studied…
A: The potential genotypes of an offspring resulting from a specific cross or breeding event are…
Q: FOH primary spermatocytes spermatozoa 1.7 Spermatids and spermatozoa exhibit some morphological…
A: Spermatogenesis is the process by which spermatids are transformed into spermatozoa. Spermatozoa…
Q: for 14. Everyone in Squidward's family has light blue skin, which is the dominant trait for body…
A: A Punnett square is an illustration of the potential genotypes of an offspring resulting from a…
Q: 2. Distinguish the root from other plant organs. 3. Explain the difference between monocot and dicot…
A: According to Bartleby guidelines, we are required to attempt first three subparts in case of…
Q: What do you think about the hypothesis that language evolved as a way for early hominins to…
A: Introduction:- The technological hypothesis proposes that gestural language evolved in early…
Q: 4. Natural selection would reduce the variation in neck length in a population of giraffes. True O…
A: Natural selection is the process in which the living organisms in a population adapt to changes. The…
Q: Discuss the diversity of gas exchange you have observed in Arthropoda?
A: Arthropoda is largest phylum of the kingdom Animalia which includes insects. Word Arthropoda is…
Q: Explain why the evolution of the four-chambered heart was critical for the development of an…
A: In animals having exothermic lifestyle (cold blooded animals), energy requirements are less compared…
Q: Which of the following could be identified as epigenetic effects?
A: This question is based on epigenetic effect.
Q: Which is the largest digestive gland present in human body? What are the names and function of its…
A: There are several glands inside the body that plays a significant role the process of digestion.…
Q: Pls help sorry for the trouble. Explain the mechanism that enables a local anesthetic to work and…
A: Mechanism of Action-Local anesthetics work to block nerve conduction by reducing the influx of…
Q: How do each of the classes of Echinoderm feed?
A: The phylum echinoderms include organisms with larvae that are bilaterally symmetrical. Here, adults…
Q: Using pencil, you will draw a representation of DNA replication along the leading and lagging…
A: DNA replication is the process that occurs in all living organisms replicate their DNA during…
Q: 3. Is the carbon dioxide the nutrient or product, or both in animal cell culturing?
A: Animal tissue culture is an invitro aseptic technique of growing cells on a specific medium. The…
Q: Pick either the pincushion cactus or the barrel cactus. Conduct an analysis and determine whether…
A: One of the most common cactus kinds for use as succulents is the barrel cactus. It is also one of…
Q: In the antibody-mediated immune response, the binding of some antigen-presenting cells to helper T…
A: Plasma cells are the cells with short life span that produce antibodies and they are derived from…
Q: MULTIPLE CHOICE Question 8 Which of the following is a TRUE statement about the rock cycle? Audio…
A: Earth is made of three major layers. The innermost layer is an iron - rich solid core.The second…
Q: Match the following statements to the type of gene they describe. ✓Encode proteins that promote cell…
A: Tumor supressor genes are those whose deletion or under expression may cause cancer. They include…
Q: What is the amount of oxygen transfer rate in the animal cell culturing?
A: An unsteady state approach was used to measure both k(L)a and k(L) at impeller speeds ranging from…
Q: Report the differences you've observed between the nucleotide sequences of the different species in…
A: The process by which species adapt to their environment over time is called evolution. The…
Q: Match each of the terms in the left with the best-fitting process in the right column promoter rho…
A: Introduction Making an RNA copy of a gene's DNA sequence is a process known as transcription in the…
Q: Lipid solubility is an important parameter that determines the predicted effectiveness of new…
A: Drugs move from a high-concentration area to a low-concentration area across a cell membrane. The…
Q: Help T K 16 Violence Prevention Center Get ready to be surprised by the world around you! Before you…
A: Alleles get segregated at the time of gamete formation. This occurs at the time of sexual…
Q: 10. In pea plants purple flowers are dominant to white flowers. If two white flowered plants are…
A: Since you have asked multiple questions, we will solve first question for you. If you want any…
Q: 1. In a population of giraffes, the average length of the neck is under stabilizing selection. O…
A: True A extremely short neck makes feeding difficult, whereas a very long neck increases the energy…
Q: For each of the following sets of traits and descriptors, give the name of the most specific primate…
A: Primates include eutherian mammals that are terrestrial mammals. They have larger brains, visual…
Q: what happens in the mitochondrion during the second stage of aerobic oxidation? pyruvate is…
A: Aerobic respiration is a type of cellular respiration that takes places in mitochondria of the…
Q: Which of the following is most likely to enter the cell via endocytosis when moving along the…
A: Membrane transport mechanism is a mechanism which evaluates how molecules/ substances are passed…
Q: Which of the following is an objective for the following study: Male birds are usually more colorful…
A: Males are often more colourful than females in the animal world because of sexual selection. This…
Discuss the Biological Pest Control methods and how they control the crop plant's environment further reduces the need for pesticides
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- Mang Isko has one hectare corn production with high-value vegetable near in it. He wanted to apply herbicide in his weed-infested corn through spraying. Is his decision effective? What do you suggest pest control? Give at least 4 sentences.Prepare a summary of this article without distorting the message it wanted to convey For farmers, pesticides save labor and generally provide a higher yield: they can mean the difference between saving a crop and losing it to disease. Some farmers, especially those who grow produce at a smaller scale, use pesticides sparingly. For example, fruit trees are susceptible to disease in northeastern regions, especially at the blossom stage. An apple or peach grower may spray their fruit trees with a fungicide once in the spring to ensure that the fruit sets, but use no further chemicals for the rest of the season. For many large row crop farmers, on the other hand, regular pesticide use is as much a part of farming as planting seeds. Spraying Roundup on a field of corn genetically engineered to withstand the chemical kills! the weeds without affecting the corn. In comparison to mechanically weeding hundreds or thousands of acres, using pesticides is a game-changer. Some farmers spray their…There is no doubt that pesticides contributed to inreasing crop production however as the use of pesticides increased concerns were expressed about their effects on humans and animals
- List down 2 insect pest each of the following crops. Describe how the insect inflictdamage to the crop. Aside from using chemicals, what specific control tactics will youuse to manage the pest?RiceMangoOnionCornShow a picture or draw Of Rice plant with the pest repellent property of Basil leaves (3d Model)You're growing cabbage and have noticed your plants have lots of insects and disease. Explain how you could use integrated pest management to help your crop be successful (either for the current season or in the future).
- Discuss weed control in Rice, Wheat and MaizeDescribe five strategies that can be used to engineer resistance into crop plants. Which strategy do you think is most likely to succeed in agroecosystems? Explain your answerDescribe how fertilizers affect disease severity. Give three examples of fertilizer practices that increase and decrease disease. What is the optimum way to use fertilizers to minimize disease?