DNA differs from RNA in the s troi a) type of phosphate b) the nucleotides c) number of carbons d) energy needed у пее

Q: V-B. Which of the following peptides would be more soluble at the indicated pH? 1. (Gly)20 or…

A: The twenty amino acids are classified into majorly the following classes: Polar Nonpolar Positive…

Q: u ivercarbUIT sugar, a phosphate group, and à nitrogenous base. 35.Most antimicrobial drugs…

A: The correct answer is (e) no level of protein structure will be disrupted. Azithromycin is an…

Q: Describe the common features of amino acid degradation

A: The proteins are considered as the polymer of the amino acids monomers, which are joined together to…

Q: Define innexin-like

A: The cells are the primary unit of life. Based on the number of cells an organism may be unicellular…

Q: 1 What is the dominant biochemical activity or molecular interaction that your protein is predicted…

A: Amyloid-beta precursor protein is single pass transmembrane protein with large extracellular domain…

Q: The peptide below NH-CH- HẠN CH- ČH, -NH-CH- NH-CH- NH-CH- OH CH2 CH2 CH2 HN-ç=NH, NH2 CH2 CH HO-CH,…

A: Amino acids are the building blocks of peptides. The net charge on a peptide depends on the sequence…

Q: Modified TRUE or FALSE. Write the word TRUE if the statement is correct. If the statement is false,…

A: Proteins are made up of amino acids, which are a type of molecule. The basic components of life are…

Q: (b) Account for the observation that the trans-,2-dibenzoylethylene appears yellow in color, whereas…

A: 1,2-dibenzoylethylene can exist in two forms, trans and cis due to lack of rotation about it's C-C…

Q: V-B. Which of the following peptides would be more soluble at the indicated pH? 1. (Gly)20 or…

A: Proteins are macromolecules that are formed by the amino acids. Amino acids act as the subunits of…

Q: Identification. Write in CAPITAL LETTERS. Wrong spelling, wrong. Proteins are classified…

A: Protein is a macronutrient that is vital for building mass. It is ordinarily found in animal items,…

Q: pH > 7 in the lungs results in     deprotonating of histidine, making it negatively charged.…

A: The pKa of the ionizable side chain of an amino acid determines whether at a particular pH the side…

Q: Select TRUE or FALSE for each of the following statements: 1. Only one of the three phosphate groups…

A: Human body is composed of different biomolecules that includes nucleic acids (DNA and RNA) proteins,…

Q: Replacements such as Lysine -- Arginine and Leucine -- Isoleucine usually have very little effect on…

A: Characteristics of amino acids:  Amino acids are the nitrogenous monomeric units of biomolecules…

Q: 1-Purines which are found mainly in both deoxyribonucleotides and ribonucleotides are     A.…

A: Nucleic acids are naturally occurring chemical compounds that is capable of being broken down to…

Q: Define the term and describe the autoantibodies presentin SLE.

A: Antibodies are Y-shaped compounds produced in the body in response to foreign agents. These are…

Q: hymotrypsin digestion, separation of peptides, and Edmann technique give the sequences for peptide…

A: Peptidases are enzymes that act on the peptide bond. Endopeptidases are enzymes that catalyze the…

Q: What are advantages of protein degradation?

A: Proteolysis targeting chimera (PROTAC) technology reveals several advantages of degradation over…

Q: What special purpose methionine serves

A: Methionine is referred to as an amino acid comprises of the sulphur group responsible for forming…

Q: Describe lysine degradation.

A: The amino acid is an organic acid that contains an alpha carboxyl group, alpha amino group, a…

Q: how many amino acids and omega bonds? How many amino acids appear to have undergone a…

A: Amino acids are amphoteric, colorless, and crystalline solids. They are soluble in water and…

Q: Give the complete name of the peptide below.

A: A peptide is a molecule that contains two or more amino acids linked together via peptide bonds. A…

Q: 63. Which of the following statements is CORRECT about protein denaturation? A. Complete protein…

A: The correct option is (b), loss of protein conformation causes loss of protein function.…

Q: Help? Please explain salting out in protein purification.

A: Protein purification:  a. The process of separating the purified end product of a protein from…

Q: Treatment of isovaleric aciduria : a. Arginine b. Lysine c. Glycine d. Methionine

A: Isovaleric aciduria occur due to defective catabolism of leucine due to deficiency of enzymes…

Q: Draw serine

A: Those organic molecules which possess two functional groups carboxylate and amino group and a…

Q: 12. Protein catabolism can yield which of the following:

A: Protein play wide variety of essential function in our body. They provide strength and structural…

Q: 70. Which of the following is a purely ketogenic amino acid? A. Tyrosine B. Leucine C. Phenylalanine…

A: The amino acids , that , after degradation, yields only acetyl co A, are known as Ketogenic amino…

Q: C9. The peptide “backbone" consists of repetitive "“units" of amino group nitrogen-alpha…

A: Proteins are biopolymers made of amino acid units. Amino acids are comprised of carbon, hydrogen, a…

Q: 10 of 16 Which of the following statements about Ubiquitin is true? O Ubiquitin, like biotin, is a…

A: Ubiquitin is a protein made up of 76 amino acid. It is used for post translational modification.

Q: P09: Write the name of-- 1.aliphatic amino acids 2.aromatic amino acids 3.sulphur containing amino…

A: Amino acids can be classified into aliphatic, aromatic, sulphur containing, polar and non polar…

Q: 61. The correct name of the peptide below is -CH-C- -CH-C- -CH N-ÇH -CH-COH H2N- ČH3 CH-CH3 CH2 CH3…

A: Introduction: The correct choice is option C).

Q: How is ubiquitination attached to the protein of interest? At which amino acid residue(s)? What…

A: Hello! Since you have posted multiple questions, we are answering only first question. If you need…

Q: Why are protein synthesis inhibitors typically broad spectrum?  What might prevent a protein…

A: Synthesis of all the proteins occur in a similar way that is every protein requires mainly these…

Q: Can you please identify what type of protein this is?

A: The correct answer is "Antiparallel beta confirmation"

Q: Translate the following DNA sequence into amino acids 5'ATAGTACCGCAAATTTATCGCT3' O…

A: Answer :-                             Met-ala-phe-lys-stop                  DNA…

Q: symptoms of phenylketonuria (pku) may be minimized or suppressed by a diet low in ___. protein…

A: A genetic mutation caused in a gene which encodes an enzyme that degrades the amino acid…

Q: 76) Nuclear localization signal can be a. Simple sequence in which we have a stretch of acidic amino…

A: A nuclear localization signal (NLS) is an amino acid pattern that 'marks' a polypeptide for nuclear…

Q: The fidelity of protein synthesis is assured twice during protein synthesis. How and when?

A: Protein synthesis occurs via two major steps- transcription and translation.  Transcription is the…

Q: assimilation is important for which two of the following amino acids? (select all that apply O…

A: The action of a number of soil organisms degrades sulfur-containing proteins into their constituent…

Q: Draw a peptide for cys-asn- pro-gly (Using the same format in picture)

A: Proteins are the building blocks of life. Proteins are made up of amino acids. Amino acids when they…

Q: please help me understand asap Please draw by hand a tripeptide of Glu, Gln, and 1 amino acid of…

A: A tripeptide is a peptide that was derived from amino acids joined by a peptide bond. where a…

Q: Using sickle-cell anemia as an example, describe what is meant by a molecular or genetic disease.…

A: Sickle-cell anemia is an autosomal recessive trait. The disease is controlled by a single pair of…

Q: Explain the 7-methylguanosine (m7G) ? Define its importance ?

A: The glycosylamines that can be thought of as nucleotides without a phosphate group are known as the…

Q: 37. Which of the 20 essential amino acids is referred to as one of the amino acids with hydrocarbon…

A: Amino acids have fundamental structure i.e, a central carbon atom or alpha (α) carbon, an amino…

Q: Discuss the potential difficulties of designing a diet to alleviate the symptoms of phenylketonuria.

A: Phenylketonuria is an inborn, autosomal recessive disorder that effects metabolism. The individuals…

Q: Referring back to the quaternary level proteins, list and describe the modifications that can be…

A: The structure of protein includes sequence of amino acids in a polypeptide chain. The formation of…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.