DNA ladder 1 DNA ladder 2 bp ng/Sul 10000 8000 40 40 6000 3000 40 4000 40 700 600 3000 40 500 -2000 100 -400 1500 40 1000 40 -300 500 40 - 200 -100 5 uI/Lane. 8 cm Gel 0.5 pg/lane, 20 cm length gel. ix TAE, B Viem, 3h Please state the band length of each well (if exist) via comparing them with DNA ladder Please write if there is any unusual band pattern (smear, primer dimer). 5% polyacrylamide 1% agarose
Q: How is a child with Type I diabetes similar to a child who is starving? Mark all that apply Both are…
A: Introduction: Type 1 diabetes is developed when the body's immune system destroys pancreatic beta…
Q: 7. Which of the following best characterizes the events that occur at an origin of DNA replication?…
A: Replication is the process of duplication of individual strands of a double stranded DNA. The…
Q: How is coral like cities? Why are they important?
A: Corals are invertebrates that belong to the Cnidaria family of colourful as well as fascinating…
Q: Draw the Fischer projections representing the L forms of the following amino acids at pH higher than…
A: Amino acids contain amino group and carboxyl group along with R side chain. The R side chain defines…
Q: What is an invasive species?
A: Invasive species can do all sorts of damage to an existing echosystem,like changing habitats and…
Q: In the presence of oxygen, the mitochondrion in yeast is used for aerobic respiration,however, under…
A: Mitochondria are organelles that can be found in the great majority of eukaryotes. They are the…
Q: 1.Which of the following are cofactors/coenzymes required for fatty acid oxidation? Choose all…
A: Fatty acids are the source of large amount of energy. Fatty acids are degraded through the process…
Q: How do insulin and epinephrine regulate glycogen metabolism in the muscle through the Glycogen…
A: The anabolic motion of insulin is antagonized through the catabolic motion of glucagon. Insulin…
Q: In an experiment of egg white and calamansi juice in protein denaturation, what will happen?
A: Proteins are one of the most important metabolites in living organisms, which is almost present in…
Q: Select the correct answer. The chemical formula for carbonic acid, a compound used in carbonated…
A: Carbonic acid (H2CO3) is a compound of the elements hydrogen, carbon, and oxygen and is formed when…
Q: Which of the following residues cannot be phosphorylated by a protein kinase? Ser His Thr Tyr Glu
A: Protein kinases are the enzymes that modify the proteins by adding phosphate groups. This is called…
Q: Match the description on the left with the correct Coenzyme A-linked thioester from the dropdown…
A: Hi. Thank you for the question. As per the honor code, we are allowed to answer three sub-parts at a…
Q: 6. CHYMOTRYPSIN IS A PROTEOLYTIC ENZYME FOUND IN THE?
A: Hi! Thank you for the question. We are authorized to answer three subparts at a time, since you have…
Q: Protein structure.Circle one of the three amino acid sequences that is most likely to form a stable…
A: The common secondary structure of the protein are alpha-helix and beta-sheets. The alpha-helix are…
Q: Draw the two possible Haworth structures (both alpha and beta anomers) for the following…
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: Organelle mixture 1.09 1.11 Centrifuge 1.15 2 - 1.19 1.22 1.25 Which fraction would you take to…
A: Sucrose density gradient centrifugation is a technique to separate subcellular organelles and for…
Q: fill in the blank Alanine can enter gluconeogenesis as an alternative carbon source for glucose as…
A: Gluconeogenesis (GNG) is the process of synthesis of new glucose from non- hexose (or…
Q: Choose one of the strands and transcribe the strand. Show the steps (with proper label) and do a…
A: The process of gene expression involves the process of transcription followed by the process of…
Q: Did chemiosmosis precedefermentation as the source ofbiological energy, or did some form…
A: Chemiosmosis is the movement of ions across a selectively permeable membrane down their…
Q: In the electron transport chain, electrons are transferred to enzyme complexes. Name the complexes…
A: Introduction: The electron transport chain involves the transfer of electrons from NADH and FADH2 to…
Q: Describe the various post-transcriptional and post-translational modifications that occur during the…
A: Post-transcriptional modifications are those modifications that occur after the completion of…
Q: Which of the following molecules require(s) a transport/ shuttle system when transported across…
A: Glucose is utilized by glycolysis process, then it converts to Acetyl CoA which enters to TCA cycle…
Q: 4. 1 3OH 12 HO, OH 5.
A: Introduction: The structure is of Ribose sugar. It is part of Polynucleotide. It's a furanose ring…
Q: You have been hired to produce a family tree for three generations of a family where a disorder…
A: Introduction: A pedigree is a diagram that shows the genotypes and phenotypes of organisms from one…
Q: Describe the processes of transcription, translation, and post-transcriptional processing.
A: Deoxyribonucleic acid is a polymer made up of two polynucleotide chains that coil around each other…
Q: Both H+ and Ca2+ are ions that move through thecytosol. Why is the movement of H+ ions so much…
A: Hydrogen bonding is very important in different biological molecules. It is also present in a number…
Q: 4. Compare DNA and RNA as to structure and components.
A: Biological molecules or the biomolecules, are the substances that are produced by cells and living…
Q: What is the standard free energy (AGº) for the reduction of coenzyme Q by NADH as carried out by…
A: Coenzyme Q (CoQ, ubiquinone) is produced across all domains of life and functions in electron…
Q: 2. The patient of 48 years old has survived a heart attack. The laboratory test of his serum blood…
A: Introduction: Cholesterol is the major sterol in animal tissue. It is present in either free of…
Q: On average, 180 liters of plasma are filtered each day. A. If humans had to expend one molecule of…
A: ATP stands for Adenosine triphosphate. The molecular formula of this compound is found to be…
Q: Look at this diagram of fally acid metabolism and malch the nutmbers wilh the enzymes, inlermediatos…
A: The Metabolism depicted is a fatty acid beta oxidation in which fatty acids are degraded into simple…
Q: E A C F В H O2 G Fumarate
A: The electron transport chain is a process in which the NADH and [FADH2] that is produced during…
Q: In which organ are ketone bodies synthesized? And in which organelle does the synthesis occur? b.…
A: Ketone bodies are generated from the precursor molecules through catabolic pathways. In catabolic…
Q: Glycogen synthase kinase 3 beta (GSK-3ß) is a serine-threonine kinase known for its ability to…
A: The given graph is a double reciprocal plot or Lineweaver-burk Plot. Solution of question a) Line B…
Q: What is the reason tolerance does not develop with drugs that target ion channels?
A: The reason that tolerance doesn't develop with drugs that Target ion channels because they are used…
Q: How do the pathways for the synthesis and breakdown of glycogen differ in liver and muscle? How does…
A: In stressful conditions/fasting/starvation when the blood glucose level is low, some…
Q: Relatively hydrophobic proteins will require higher amounts of (NH4)2SO4 to precipitate.
A: Amminium sulfate precipitation is a method of protein purification by altering solubility of…
Q: A polypeptide contains 36 amino acids. How many nucleotides should be found in the open reading…
A: A codon is a sequence of three consecutive nucleotides in a DNA or RNA that codes for a specific…
Q: 1. Sodium error encountered in using a pH meter causes a/an increase in the pH reading of a solution…
A: We'll answer the first three questions since the exact one wasn't specified. Please submit other…
Q: value of AG" for the conversion of 3-phosphoglycerate to 2-phosphoglycerate (2PG) is +4.40 kJ/mol.…
A: dGo = -RTlnKeq T = 25 + 273 = 298 K Keq = [2-phosphoglycerate]/[3phosphoglycerate]
Q: Question 2 What can we most-accurately say about the polypeptide with the primary sequence KNEADING?…
A: The amino acids are classified on the basis of polarity of the side chain into nonpolar and polar.…
Q: What is the basis for the lowfrequency of errors in DNA replicationobserved in all cells? Is this…
A: The genetic material that gives each cell its identity is DNA. Before a cell replicates and divides…
Q: 2 A biomolecule has a K_d of 1.6mM. A mutated-version of the same biomoleucel was bound by ligan by…
A: Given to us are ligand concentration [L] = 1mM 35% of mutated biomolecule is in bound form,…
Q: 1)What are the main roles of the following amino acids; (within the crystal structure and/or active…
A: Hi! Thank you for the question. We are authorized to answer three subparts at a time, since you have…
Q: Place the stages of PCR in the correct order -Anneal -Denature -Analyse -Extend
A: Polymerase chain reaction (PCR) is a laboratory technique for rapidly amplifying DNA to produce…
Q: and artificial sweeteners. a) Draw a Haworth projection of the following a-D-glucose, B-D-fructose,…
A: The glucose has a six-membered pyran ring, and the fructose has a five-membered furanose ring. The…
Q: Heating an enzyme makes it no longer function correctly because the heat: O A) removes phosphate…
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: Briefly discuss how SLBs may be used to study drug-membrane interactions.
A: Lipophobic / Hydrophilic drugs cannot pass the Lipophilic/hydrophobic phospholipid bilayer of cells.…
Q: 9. Catabolism, the degradative phase of metabolism, is said to be convergent. This mea that: A. the…
A: Introduction: The term catabolism refers to the breakdown of large complex molecules to form…
Q: Complete the following table by indicating the appropriate enzyme FULL names (from 1 to 4) affected…
A: The Krebs cycle (citric acid cycle) carry out the complete oxidation of acetyl CoA produced as the…
Step by step
Solved in 2 steps
- Heteroduplex DNA Formation in Recombination From the information in Figures 28.17 and 28.18, diagram the recombinational event leading to the formation of a heteroduplex DNA region within a bacteriophage chromosome.Homologous Recombination, Heteroduplex DNA, and Mismatch Repair Homologous recombination in E. coli leads to the formation of regions of heteroduplex DNA. By definition, such regions contain mismatched bases. Why doesn’t the mismatch repair system of E. coli eliminate these mismatches?Three DNA molecules (DNA1: ATATAT; DNA2: ATCGAT, DNA3: CGCGCG) were separated by DNA denaturation experiment. Please draw the DNA denaturation (DNA melting) curves corresponding to the three molecules and annotate X and Y axis.
- DNA ladder is attached (the picture shows HindIII as H, EcoRI as E, BamHI as B). Now, determine the size of fragments created by EcoRI and BamHI. In the graph attached there is the fragment size of HindIII. HindIII EcoRI BamHI Migration Distance (mm) Fragment Size (bp) Migration Distance (mm) Fragment Size (bp) Migration Distance (mm) Fragment Size (bp) 23455 11985 7430 4375 2150 1850Can you please help with 1d please picture with 1 graph is for question 1a) picture with 4 graphs is for question 1b) 1a) E. coli DNA and binturong DNA are both 50% G-C. If you randomly shear E. coli DNA into 1000 bp fragments and put it through density gradient equilibrium centrifugation, you will find that all the DNA bands at the same place in the gradient, and if you graph the distribution of DNA fragments in the gradient you will get a single peak (see below). If you perform the same experiment with binturong DNA, you will find that a small fraction of the DNA fragments band separately in the gradient (at a different density) and give rise to a small "satellite" peak on a graph of the distribution of DNA fragments in the gradient (see below). Why do these two DNA samples give different results, when they're both 50% G-C? 1b) If you denatured the random 1000 bp fragments of binturong DNA that you produced in question 1a by heating them to 95ºC, and then cooled them down to 60ºC…E. coli cells grown on 15N medium are transferred to 14N mediumand allowed to grow for two more generations (two rounds ofDNA replication). DNA extracted from these cells is centrifuged.What density distribution of DNA would you expect in thisexperiment?(A) one high-density and one low-density band(B) one intermediate-density band(C) one high-density and one intermediate-density band(D) one low-density and one intermediate-density band
- A single strand of DNA, 24 nucleotides long, with the sequence 5'-TTTCCCgggAAAgggTTTAAAggg-3' is in a test tube. (Note that G's are shown in lowercase, so that your eye can better distinguish them from C's) Other than the appropriate buffer solution, what else needs to go in the test tube to so that we end up with a piece of double stranded DNA, 24 base pairs long, with the above sequence comprising one of the two strands?True or False 1. In a dsDNA, a pyrimidine in one chain is always paired with a purine on the other chain because of this arrangement, the molecule is 2nm wide along its entire length. Example is A with G or C with T.This image shows DNA (gray) interacting with a computergenerated model of a TAL protein (multicolored), one of afamily of proteins found only in a species of the bacteriumXanthomonas. The bacterium uses proteins like this one to findspecific gene sequences in cells of the organisms it infects, suchas tomatoes, rice, and citrus fruits. Given what you know aboutDNA structure and considering the image above, discuss howthe TAL protein’s structure suggests that it functions
- A plot showing the % of denautration as a function of temperature for a melting point of a DNA sample under 0.12 M NaCl gives an equation of a line of Y= 0.0074 X - 0.044 (Where Y is the % of denautration and X is the temperature in degree C) This is all the information that was given. 1. Calcuate the melting point of this DNA in degree CDNA of different densities is distinguished by a procedure called caesium chloride (CsCI) densitycentrifugation. Spinning CsCI at high speeds for many hours generates a gradient of caesium andchloride ions. The highest ion concentration, or density, occurs at the bottom of the tube.b. In this experiment, where on the cesium chloride (CsCI) gradient would the following DNAbe found (low density, middle density, or high density):Double stranded DNA where both strands are labeledDouble stranded DNA where one strand is labeledDouble stranded DNA where neither strand is labeledDNA polymerase requires both a template, to be copied, and a primer, which provides a 3′ hydroxyl from which polymerase can extend. Yet, this molecule supports DNA polymerase activity. Explain. pTGACACAGGTTTAGCCCATCGATGGG -OH