DNA ladder Sample digested with EcoRI negative electrode 23- This is the result of gel electrophoresis of the unknown DNA 8000 bp (base pairs) sample digested with EcoRI. The size of three fragments are indicated in the result (8000 bp, 5800 bp, and 850 bp). 5800 bp (1) How many ECORI restriction enzyme cut site are available 2.3 in the unknown DNA? (Assume that the DNA was fully 850 bp digested with EcoRI) positive electrode slab of agarose (2) What is the size (bp) of the unknown DNA? (A) nucleotide pairs (x 1000)

DNA ladder Sample digested with EcoRI negative electrode 23- This is the result of gel electrophoresis of the unknown DNA 8000 bp (base pairs) sample digested with EcoRI. The size of three fragments are indicated in the result (8000 bp, 5800 bp, and 850 bp). 5800 bp (1) How many ECORI restriction enzyme cut site are available 2.3 in the unknown DNA? (Assume that the DNA was fully 850 bp digested with EcoRI) positive electrode slab of agarose (2) What is the size (bp) of the unknown DNA? (A) nucleotide pairs (x 1000)

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 18P: Functional Consequences of Y-Family DNA Polymerase Structure The eukaryotic translesion DNA...

See similar textbooks

Similar questions

Although DNA polymerases require both a template and a primer, the following single-stranded polynucleotide was found to serve as a substrate for DNA polymerase in the absence of any additional DNA.3′ HO-ATGGGCTCATAGCCGGAGCCCTAACCGTAGACCACGAATAGCATTAGG-p 5′What is the structure of the product of this reaction?
5’-GATCAGCTGACTGGATCCGTCCTCAACGTCAGGATCCAGCTTCAAG-3’ 1. How many cuts do you expect this enzyme to make on the above DNA and how many fragments do you expect to see on your gel? Assume that they are all different sizes.
The total (50ul) of your restriction digest contains 500ng of DNA how much DNA (ng) are you loading into the gel?
The recognition sequence for the restriction enzyme Sau3AIis GATC; in the recognition sequence forthe enzyme BamHI—GGATCC—the four internal bases areidentical to the Sau3AI sequence. The single-stranded endsproduced by the two enzymes are identical. Suppose youhave a cloning vector that contains a BamHI recognitionsequence and you also have foreign DNA that was cut withSau3AI. Can this DNA be ligated into the BamHI site of the vector,and if so, why?
Do virtual restriction digests of 300ng pGLO plasmid using HinDIII, EcoRI, and XhoI separately, and a double digest of pGLO with HinDIII plus EcoRI. How many nanograms of DNA should we expect to be contained within the slowest bandfrom the HinDIII-digest of pGLO?
DNA renaturation curves occasionally show three distinct phases of renaturation. In this graph, DNA renaturation is plotted against C0t (initialconcentration times time of renaturation—essentially a measure of relativerenaturation time). See Figure 21.3.(a) Identify each part of this plot that corresponds to reannealing of (1)unique sequences, (2) moderately repetitive sequences, and (3) highlyrepetitive sequences.(b) Suppose that you cloned a single-copy gene, such as the gene for dihydrofolate reductase (DHFR), into a plasmid vector and subjected it torenaturation analysis. Sketch the curve you might expect.(c) Suppose that you used reverse transcriptase to copy the ovalbumin mRNA and cloned this complementary DNA (cDNA) into a plasmid vector. Would you expect this cDNA to reanneal (1) more slowly, (2) more rapidly, or (3) at the same rate as genomic DNA? Briefly explain your answer.
The temperature at which a DNA sample denatures can be used to estimate the proportion of its nucleotide pairsthat are G- C. What would be the basis for this determination, and what would a high denaturation temperature for aDNA sample indicate?
The restriction endonuclease NciI recognizes and cuts the five-base-pair sequence 5’- CC(G/C)GG-3’ [where (G/C) means either G or C will work at that position]. (1) How often, on average, would this sequence occur in random DNA? Assume the DNA contains 25% each of A, G, T & C. (2) After digestion, Nci1 leaves a one-base 5’ overhang. Write/draw the cut site/digested products.
Given: BamHI, cleaves after the first G: 5’ G GATCC 3’ 3’ CCTAG G 5’ AND BclI cleaves after the first T: 5’ T GATCA 3’ 3’ ACTAG T 5’ THEN -- Given the DNA shown below: 5’ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG3’ 3’TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC5’ i) If this DNA was cut with BamHI, how many DNA fragments would you expect? ii) If the DNA shown above was cut with the enzyme BclI, how many DNA fragment would you expect?
1. You have the plasmid pUC18/19, which is a circular plasmid that consists of 2686 bp. What would the number of and length of the fragments be if you cut the plasmid with the following restriction enzymes or combination of enzymes? Give a schematic representation of the digestions. a. PscI & GsuI b. ScaI, PdmI & BsaXI c. ScaI, SspI & EheI 2. You have determined that the amplicon you want to clone has enzyme restriction sites for HindIII and EcoRI. After investigation you have seen that the pUC18/19 plasmid also have these enzyme restriction sites in its multiple cloning site (MCS on map above). After enzyme digestion your amplicon is 854 bp long. a. What length will the recombinant plasmid be after you have inserted your amplicon? Show your calculation. b. In the amplicon insert you have an enzyme restriction site for NdeI at 500 bp. If you digest the recombinant plasmid with this enzyme what length will the fragments be?
Heteroduplex DNA Formation in Recombination From the information in Figures 28.17 and 28.18, diagram the recombinational event leading to the formation of a heteroduplex DNA region within a bacteriophage chromosome.
Semiconservative or Conservative DNA Replication If 15N-Iabeled E. coli DNA has a density of 1.724 g/mL, 14N-labeled DNA has a density of 1.710 g/mL, and E. coli cells grown for many generations on 14NH4+as a nitrogen source are transferred to media containing 15NH4+as the sole N-source, (a) What will be the density of the DNA after one generation, assuming replication is semiconservative? (b) Suppose replication took place by a conservative mechanism in which the parental strands remained together and the two progeny strands were paired. Design an experiment that could distinguish between semiconservative and conservative modes of replication.