Q: Question 4. You are analyzing cells that you have grown on coverslips and fixed. What method would…
A: Option A is incorrect because a western Blot is an analytical technique used to detect and measure…
Q: under the same cell culture conditions that lead cultured normal cells to reduce their growth rates,…
A: Malignant cells are cancerous in nature.
Q: Which one of the following is true regarding spinal cord and spinal nerves? "spinal nerves are…
A: Introduction :- The spinal nerves are made up of 31 symmetrical pairs that connect the spinal cord…
Q: metals to different xenobiotic
A: There are basically five main possible mechanisms of heavy metal resistance of microorganisms-
Q: Which enzyme is responsible for unwinding and separating the parental DNA strands? a polymerase…
A: Each parental strand provides a blueprint for the synthesis of a new complimentary daughter thread…
Q: (a) Compare and contrast some of the different mechanisms used by pathogens to establish an…
A: Pathogens are any microbes that can cause infection and diseases in plants and animals. The…
Q: Which characteristic of inflammation results in the abnormal findings seen in glomerulonephritis?
A: Increased capillary permeability ,a characteristic of inflammation results in abnormal findings seen…
Q: Which statement is TRUE regarding the DNA ligase mechanism?
A: DNA ligases DNA ligases are the enzymes that are responsible for joining the two strands of DNA by…
Q: 1. What is the significance of use of potato in the preparation of culture media? 2. What is the…
A: To identify the microorganism, it must first be placed into a medium to commence development, and…
Q: 7. Which of the following statements about terpenes is NOT true? a. They are a type of terpenoid. b.…
A: 7- All statement are correct except d. They all contain oxygen. Terpenes are the type of terpenoids…
Q: QUESTION 4 Target cel receptors can be activated or inhibited by specific hormones O True O False…
A: Hormones attach to receptors on target cells, causing biological changes. In reaction to hormone…
Q: What are mechanisms of resistance in plants to different xenobiotics? Thank you!
A: Any chemical or other substantiation that plants could use for growth and development is referred to…
Q: ATP hydrolysis is directly coupled to the movement of O a. glucose across the animal-cell plasma…
A: The movement of the calcium ions across the membrane requires the energy and this transport of the…
Q: What were the two major goals of the Human Genome Project? Select all that apply. a to isolate…
A: Introduction :- The Human Genome Project was an international scientific research project aimed at…
Q: Find and describe 5 animal that uses camouflage and identify what camouflage tactics they use
A: INTRODUCTION Another adaptation that aids an animal's survival in its environment is camouflage.…
Q: Minerals are normally being absorbed in the large intestine
A:
Q: Coelochaetes (green algae) Charophytes (green algae) Ancestral green algae Bryophytes…
A: Phylogenetic tree Phylogeny is the study of the history of the evolutionary relationship between…
Q: Cloning mammals is the source of much concern and controversy. Which of the following is not a…
A: Consumers have various worries about cloned animals. These animals have a hard time producing live…
Q: a. We have a molecule 2,3-bisphosphoglycerate (BPG), which is a negative allosteric modulator for…
A: 2,3-Bisphosphoglycerate (2,3-BPG) is a three-carbon isomer of the glycolytic intermediate…
Q: Describe the mechanism of V(D)J recombination. At which level in the B-cell development does V(D)J…
A: Each of the two polypeptide chains in immunoglobulins and T cell receptors contributes to the…
Q: 8 Fishermen in Texas have been catching largemouth bass at higher rates than normal. This increase…
A: Every organism has its role in an ecosystem. They occupy a trophic level in the food chain and eats…
Q: Which statement is not true of the zygomycetes? (a) many members of this group form endomycorrhizae…
A: Introduction :- The Zygomycetes, also known as 'pin moulds,' are true fungi that form extended…
Q: List the four most common elements in organic molecules and state which common macromolecules always…
A: Introduction Biomolecules such as carbohydrates, lipids, proteins, nucleic acid, etc. are very…
Q: When Laybourne and Kadonaga studied the effects of histone proteins on eukaryotic transcription…
A: a) To clarify the mechanism of transcriptional repression by the nucleosomal cores they considered…
Q: Question 2 Cutting DNA into various size fragments is part of... Genetic fingerprinting Genetic…
A: Answer
Q: Justify why algal biotechnology has the potential to be the future of climate change mitigation
A: Algae can help combat climate changes by removing CO2 from the atmosphere, storing it as biomass,…
Q: oviposition for
A: Oviposition means expulsion of the egg from the oviduct to the external environment. eggs or female…
Q: 1) Give the genotype of the offspring (this time simply follow the given sequence above and separate…
A: There are three types of genes in Drosophila . These are :- I ) Cinnabar eyes :- Cinnabar eyes are…
Q: 5. Pernicious anemia is a disease in VITAMIN B12 which the intestine is unable to absorb vitamin…
A:
Q: 4) Describe in detail how p53 and MDM2 regulate cell division in a normal, healthy cell. You should…
A: There are two proteins called MDM2 and p53 which plays an important role in regulation of cell…
Q: Which of the following crosses would always result in offspring that only display the dominant…
A: The dominant trait is a trait that expresses itself in the F 1 generation or in heterozygous…
Q: Describe stages for the extravasation of neutrophils during inflammation. Include in your…
A: Introduction Immunity: it is the property/capability of our system to fight against the harmful…
Q: _____ is a change in the order of one nucleotide in a section of a DNA molecule. a Point mutation b…
A: Option A is correct because a point mutation is a type of mutation in DNA or RNA, the cell's…
Q: Question 10. This graph shows data on incidence of stomach cancer in Japanese people living in Japan…
A: Cancer is a disease condition in which the body's cells grow in an uncontrollable way or in a way…
Q: Receptor mediated endocytosis requires the presence of a) primary active transport pumps. D) carrier…
A: Introduction Endocytosis is the formation of an intracellular membrane-bounded vesicle containing…
Q: Food Science/ Bio
A: In healthy adults, proteins make up relatively 15.% of body mass and it is responsible for most of…
Q: a researcher isolates mRNA from a healthy and diseased liver biopsies. each mRNA sample is converted…
A: RNA molecules were relegated as a simple intermediate between genes and proteins, as encapsulated in…
Q: Why was sequencing the human genome such a formidable task?
A: Human Genome Project is a project which tells about the DNA sequence of the complete human genome.…
Q: Describe vaccination in aquaculture, what happens to to the fish organsim’s body. What are the…
A: Introduction Aquaculture:- It is also known as 'aqua farming' or 'aquiculture', It is breeding,…
Q: Even in the absence of genetic recombination, meiosis is an important source of genetic variation in…
A: INTRODUCTION Genetic variation refers to differences in some of the genomes of members of identical…
Q: Match the receptors in column A with the stimulus it perceives la column B and the type of receptor…
A: Types of receptors - Chemoreceptor Thermoreceptor Mechanoreceptor Photoreceptor
Q: In mRNA processing, the first protein to bind to the signaling region near the cleavage site of the…
A: Pre-mRNAs are processed in three phases in eukaryotic cells:Ending at the 5' mark.At the 3' end, a…
Q: After decades of work, Dr. Ricky M. isolated a small amount of attractase—an enzyme that produces a…
A: A gene is the essential physical and functional unit of heredity. Genes are comprised of DNA. A…
Q: Question 2. Which of the following is a molecule formed by a dehydration synthesis reaction? A.…
A:
Q: Discuss the following virulence factors: collagenase, hemolysin, siderophore. For each, explain the…
A: Please follow step 2 for detailed explanation
Q: What is the role of regulatory gene mutations in cancer?
A: Regulatory genes are defined as genes which control or regulate the expression of one or multiple…
Q: Draw out the “investment” steps of glycolysis, showing complete structures, names of intermediates,…
A: l
Q: 1. Distinguish between male and female cones in gymnosperms. 2. Describe the generalized life cycle…
A: 1) Male cones of gymnosperms are smaller than the female cones, which are found in the lower part…
Q: Characterize the unique nature of a lichen.
A: Introduction A lichen is a symbiotic connection between two organisms, a green alga or…
Q: The four nitrogen bases in RNA are adenine, _______, _______, and _______. Select all that apply.…
A: Introduction :- Ribonucleic acid is a nucleic acid that has structural similarities to DNA and is…
I need help, I'm very confused
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Give me nucleotide sequence with pairing. Like this ATC TCA TGA GCC TAG AGT ACT. CGG3. The sequence below used the sequence in “1” and encountered a point mutation: TAC-CTA-CGT-AGG-GTT-TAC-ACC-ACA-AGC-CGT-TGG- AAT -GTG-CCA-AAG-TTG-CAG-TGA-AGG- TGA-TGC-TAG-TGA-AAG-CTA-GAT-AGG-GCT-TAT-ATG-AGA-TTT-CGC-CCC-CGA-TAC-GAT-TTG- CTG-AAT-AGA-CTC-GAT-GAA-TCG-CGC-GAT-GTT-ACT a. Determine the mRNA produced by transcription: b. Determine the amino acid sequence after translation (USE “-“ TO SEPARATE AMINO ACIDS, NO SPACES): c. What is the type of point mutation that occurred? A. Nonsense B. Silent C. Missense3. The sequence below used the sequence in “1” and encountered a point mutation: TAC-CTA-CGT-AGG-GTT-TAC-ACC-ACA-AGC-CGT-TGG- AAT -GTG-CCA-AAG-TTG-CAG-TGA-AGG- TGA-TGC-TAG-TGA-AAG-CTA-GAT-AGG-GCT-TAT-ATG-AGA-TTT-CGC-CCC-CGA-TAC-GAT-TTG- CTG-AAT-AGA-CTC-GAT-GAA-TCG-CGC-GAT-GTT-ACT a. Determine the mRNA produced by transcription: b. Determine the amino acid sequence after translation (USE “-“ TO SEPARATE AMINO ACIDS, NO SPACES): c. What is the type of point mutation that occurred? 4. The sequence below used the sequence in “1” and encountered a type of frameshift mutation: TAC-CTA-CGT-AGG-GTT-TAC-ACC-ACA-AGC-CGT-TGG-AAC-GTG-CCA-AAG-TTG-CAG-TGA-AGG- TGA-TGC-TAG-TGA-AAG-CTA-GAT-AGG-GCT-TAT-ATG-AGA-TTT-CGC-CCC- CGT -ACG-ATT-TGC- TGA-ATA-GAC-TCG-ATG-AAT-CGC-GCG-ATG-TTA-CT a.Determine the mRNA produced by transcription: b.Determine the amino acid sequence after translation (USE “-“ TO SEPARATE AMINO ACIDS, NO SPACES): c.What is the type of point mutation that occurred? a. Silent mutation…
- What is the corresponding mRNA sequence of the polymer? 3'CAG TTA AGC CTC GGT TAC CAG GAT ACG GGA 5'The sequence below used the sequence in “1” and encountered a type of frameshift mutation: TAC-CTA-CGT-AGG-GTT-TAC-ACC-ACA-AGC-CGT-TGG-AAC-GTG-CCA-AAG-TTG-CAG-TGA-AGG- TGA-TGC-TAG-TGA-AAG-CTA-GAT-AGG-GCT-TAT-ATG-AGA-TTT-CGC-CCC- CGT -ACG-ATT-TGC- TGA-ATA-GAC-TCG-ATG-AAT-CGC-GCG-ATG-TTA-CT a. Determine the mRNA produced by transcription: b.Determine the amino acid sequence after translation (USE “-“ TO SEPARATE AMINO ACIDS, NO SPACES): c.What is the type of point mutation that occurred? A. Silent B. Nonsense C. MissenseWhat’s the resulting amino acid sequence? 3’CAG TTA AGC CTC GGT TAC CAG GAT ACG GGA 5’
- CONVERT THE FOLLOWING: DNA - ACA AGA CGG TAC TGA mRNA - _______________ tRNA - _______________ Amino Acids:A gene contains the sequence CGCATACGGTAC that results in the amino acid sequence arg-ile-arg-tyr. A mutation in this gene removes the first G in the strand.What is true of this mutation's effect on the phenotype?1.It will affect the phenotype because although most of the protein will be identical, the first amino acid will be different.2.It will not affect the phenotype because the protein will be identical to the original protein.3.It will affect the phenotype because all the amino acids past this point will be different from the original protein.4.It will not affect the phenotype because only the first amino acid is different from the original protein.Arg-ser-ser-ala-pro Possibilities mRNA 3’ AGG UCA UCU GCU CCC 5’ 5’ ACC ACG CCU CCU GGC 3’ 3’ UCC ACG CCU ACU GGA 5’ 5’ CGC UCC CCU GCC CCC 3’ Possibilities coding strand 5’ TCC TCG ACT GCT GGA 3’ 3’ TCC TCG TGA CGA CGC 5’ 5’ CGG ACT ACT GCA CCA 3’ 3’ CCC ACG ACT CCT CGC 5’ Possibilities non- coding strand 3’ GGG TCA TCA CGG GGG 5’ 5’ TCC AGC AGC CGC GGC 3’ 3’ GCC TCA AGC CGA GGA 5’ 5’ TGG TGC TGA AGA TCA 3’
- PLEASE MAKE THE DR BRUJIN GRAPH From these k-mers construct a de Bruijn graph and determine the sequence of the contig. AGCG ATCT ATGA ATGG ATTC CCCT CCTG CTCT CTGA CTGC CTTT GAAG GATT GCGT GCTC GTTC TATG TCAT TCTA TCTT TGAA TGAT TGGA TGTT TTCA TTCC TTTCEnhanced Spatial Learning in Mice With an Autism Mutation Autism is a neurobiological disorder with symptoms that include impaired social interactions and stereotyped patterns of behavior. Around 10 percent of autistic people have an extraordinary skill or talent such as greatly enhanced memory. Mutations in neuroligin 3, an adhesion protein that connects brain cells to one another, have been associated with autism. One mutation changes amino acid 451 from arginine to cysteine. In 2007, Katsuhiko Tabuchi and his colleagues genetically modified mice to carry the same arginine-to-cysteine substitution in their neuroligin 3. Mice with the mutation had impaired social behavior. To test spatial learning ability, the mice were placed in a water maze: a deep pool of warm water in which a platform is submerged a few millimeters below the surface. The platform is not visible to swimming mice. Mice do not particularly enjoy swimming, so they locate a hidden platform as fast as they can. When tested again, they can remember its location by checking visual cues around the edge of the pool. How quickly they remember the platforms location is a measure of spatial learning ability (FIGURE 15.18). FIGURE 15.18 spatial learning ability in mica mutation in neuroligin 3 (R451C), compared with unmodified (wild-type) mica. 2. Did the modified or the unmodified mice learn the location of the platform faster in the first test?3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Make vertical lines between codons to make this assignment easier to do. Which strand is the template strand? The first strand is the template strand as it going 3-5 Copy the template strand in mRNA. Label the 5’ and 3’ ends. 5' AUG UUA CCC GCU GCG CGA AGC AAA GUC UAA 3” Write out the amino acid (you can use the short form) that this protein would be made of (keep in mind proteins are usually a minimum of 50 proteins. Met-Leu-Pro-Ala-Ala-Arg-Ser-Lys-Val What do you notice about the mRNA strand compared to the non template strand of DNA? 2. What amino acid does the second codon code for on the DNA template strand? ______Assume the 6th amino acid in the strand is changed from a T to a C. What amino acid does it code for now? _______ What type of mutation is this? 3. Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would…
