DNA polymerases are processive, which means that they remain tightly associated with the template strand while moving rapidly and adding nucleotides to the growing daughter stand. Which piece of the replication machinery accounts for this characteristic? Helicase O Sliding Clamp O Single Stranded Binding Protein Primase

DNA polymerases are processive, which means that they remain tightly associated with the template strand while moving rapidly and adding nucleotides to the growing daughter stand. Which piece of the replication machinery accounts for this characteristic? Helicase O Sliding Clamp O Single Stranded Binding Protein Primase

Name: DNA polymerases are processive, which means that they remain tightly
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: DNA polymerases are processive, which means that they remain tightly associated with thetemplate strand while moving rapidly and adding nucleotides to the growing daughterstand. Which piece of the replication machinery accounts for this characterist

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 20QP: What is the function of DNA polymerase? a. It degrades DNA in cells. b. It adds RNA nucleotides to a...

See similar textbooks

Similar questions

What is the function of DNA polymerase? a. It degrades DNA in cells. b. It adds RNA nucleotides to a new strand. c. It coils DNA around histones to form chromosomes. d. It adds DNA nucleotides to a replicating strand. e. None of these.
What is the importance of complementary base pairing to DNA replication?
Which of the following components is not involved during the formation of the replication fork? single-strand binding proteins helicase origin of replication ligase
During DNA replication, the function of RNA primers is to Group of answer choices serve as a binding site for DNA ligase separate the two strands of the double helix to open replication "bubbles" serve as starting points for DNA strand elongation by DNA polymerase in the 3' - 5' direction prevent new-separated strands of DNA from rejoining serve as starting points for DNA strand elongation in the 5' - 3' direction by DNA polymerase
In DNA replication, the fundamental reason that Okasaki fragments are produced is that Group of answer choices DNA replication can proceed only in the 5’ to 3’ direction replication on the leading strand is slower than replication on the lagging strand DNA polymerase tends to slip while replicating the lagging strand DNA polymerase has to alternate between the leading and lagging strands during replication none of these are true.
Semi-discontinuous replication means that: DNA synthesis only occurs in the same direction as the replication fork. the double helix unwinds and each strand serves as a template for a new DNA molecule. there are Okazaki fragments associated with the leading strand. DNA synthesis occurs in both a 5’ to 3’ and a 3’ to 5’ direction. there is both a leading and a lagging strand associated with each replication fork.
During eukaryotic DNA replication, _________ synthesizes short RNA primers. The primers provide a 3'-OH group to which DNA nucleotides are be added by DNA polymerase. DNA gyrase (topoisomerase) DNA helicase DNA ligase primase
The purpose of DNA gyrase in replication is: to relieve positive supercoiling induced by unwinding the DNA during replication. to induce tighter coiling in supercoils. to remove the RNA primers from the lagging strand at each Okazaki fragment to start unwinding and separate the DNA to initiate replication to provide energy to remove a diphosphate fragment from each nucleoside triphosphate.
Single-stranded regions of DNA are attacked by nucleasesin the cell, yet portions of DNA are in a single-stranded form during the replication process. Explain.
The region of DNA, shown below, is being copied. Diagram what happens when the second GT repeat (newly synthesizing strand) slips out (loops out). Diagram what occurs in this and the next round of DNA replication. Describe the change in the DNA sequence that occurs due to this replication slippage. 5’TGCCAGTGTGT3’ACGGTCACACACACATGGAG5’
How would nucleotide excision repair be affected if one of the followingproteins was missing? Describe the condition of the DNAif the repair was attempted in the absence of the protein.A. UvrAB. UvrCC. UvrDD. DNA polymerase
During DNA replication in E. coli, which enzyme forms the phosphodiester bond between an RNA primer and the first incoming deoxyribonucleotide for an Okazaki fragment on the lagging strand? topoisomerase DNA polymerase III DNA helicase DNA polymerase II DNA ligase