DNA replication is considered semiconservative because _______. Select one: it will create a new identical strand to the template. it can replicate from two directions (bidirectional) from the origin(s). it uses one old strand as a template for the synthesis of a new strand. it always repli

DNA replication is considered semiconservative because _______. Select one: it will create a new identical strand to the template. it can replicate from two directions (bidirectional) from the origin(s). it uses one old strand as a template for the synthesis of a new strand. it always repli

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter6: Dna Structure And Function

Section: Chapter Questions

Problem 10SQ

See similar textbooks

Related questions

Q: Given a part of DNA undergoing replication. Copy and write the corresponding bases in the new…

A: Semiconservative mode of DNA replication describes the mechanism of DNA replication in all living…

Q: The spontaneous loss of amino groups from adenine in DNA results in hypoxanthine, an uncommon base,…

A: Cells have various mechanism to avoid the mutations. During DNA replication, most DNA polymerases…

Q: A DNA strand has the following sequence: 5′–GATCCCGATCCGCATACATTTACCAGATCACCACC–3′In which…

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: Draw a replication fork and label 5 enzymes involved in DNA replication. Describe the function of…

A: Replication is the process of synthesis of DNA from the parental DNA.

Q: Which of the following best describes the process of DNA replication? (type 1, 2 or 3 in the blank)…

A: There are a number of processes necessary for the continuation of generation, growth and development…

Q: Because a newly synthesized DNA molecule consists of one old strand and one new strand, DNA…

A: Introduction DNA replication is very crucial for the continuation of life as every new daughter…

Q: Which of the following models describes the way in which DNA Replication occurs? dispersive…

A: DNA double helix model given by Watson and crick and they proposed various model how DNA replication…

Q: DNA replication begins with the pre-replication complex binding to _____________ and beginning to…

A: Answer: REPLICATION : It is the process in the central dogma where DNA strands unwinds and…

Q: Which of the following is part of the elongation step of DNA synthesis?a. pulling apart the two DNA…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: Before a cell divides, it duplicates its DNA in a process called Replication molecule unzips into…

A: Molecular Biology is the branch of biology that deals with a study of the composition, arrangement,…

Q: The following diagram uses colors to illustrate the replication of a chromosome. Use your knowledge…

A: DNA is the genetic material which stores all the genomic information needed for survival of any…

Q: In the replication of a DNA molecule, two daughter molecules, Q and R, are formed. The following…

A: DNA replication is a biochemical process in which DNA molecules produce duplicate molecules of…

Q: Which of the following is true about DNA polymerase?a) It can synthesize DNA in the 5’ to 3’…

A: DNA polymerase is an enzyme that synthesizes DNA molecules from deoxyribonucleotides, the building…

Q: the diagram below, a dotted line represents newly-synthesized DNA. What process is being shown?…

A: DNA replication is a process which is involved in the production of the two identical copies of the…

Q: Which of the following is not a feature of eukaryotic DNA replication? a. Replication bubbles move…

A: DNA (deoxyribonucleic acid) is the genetic material of an organism. The specific nucleotide sequence…

Q: Draw replication forks that show what you would expect to see if a cell were unable to make the…

A: Replication is the process of synthesis of new DNA strand from the existing ones. The existing DNA…

Q: In the lagging strand, DNA is made in the direction _________ the replication fork and is made as…

A: The DNA replication is the process by which the genetic material of the organism copies itself to be…

Q: DNA is synthesized through a process known as ....... translation semiconservative…

A: At the point when a cell divides, it is vital that every daughter cell gets an indistinguishable…

Q: DNA Template: AAC CGA TCC TAT CGG AAA TTT TGC ATG ATC TAT Give the nucleotide sequence after DNA…

A: The replication is the process of new DNA synthesis from the old DNA. The transcription is the…

Q: If a cell were damaged, & DNA ligase could no longer be produced, how would replication be affected?

A: Each strand of DNA participates in DNA synthesis due to its double helix structure. DNA synthesis is…

Q: The enzyme required to open up the double stranded DNA during replication and form the replication…

A: Replication Replication is a process by which the DNA synthesised exact copies of itself. This is…

Q: A new DNA strand elongates only in the 5' to 3' direction because _____.

A: Answer - Option C - DNA polymerase can add nucleotides only to the free 3' end

Q: In the replication of a DNA molecule, two daughter molecules, Q and R, are formed. The following…

A: DNA replication is the process of producing a DNA strand from the exiting DNA strand by dividing the…

Q: The enzyme known as ________ uses ________ and separates the DNA strands at the replication fork. a.…

A: DNA Replication is the biological process of generating exact copies of DNA from the original DNA…

Q: DNA replication is considered semiconservative because the________ strand will remain as half of the…

A: The DNA replication is the process by which the genetic material of the organism copies itself to be…

Q: A cell experiences a mutation where the DNA polymerase III enzyme can now add nucleotides to either…

A: A "nucleic acid" is a linear polymer of nucleotides that is a component of the cell's information…

Q: uring DNA replication the synthesis of the leading strand of DNA results in fragments known as:…

A: During cell division, DNA replication is the process by which DNA duplicates itself. A replication…

Q: DNA replication is called semi- conservative because of the two new strands of DNA is old DNA from…

A: In the process of DNA replication, the two strands of the DNA separates and both the strands act as…

Q: Which of the following statements about DNA replication is FALSE? ORNA primers play a role in…

A: DNA replication is the synthesis of new copies of DNA and occurs before cell division. It occurs in…

Q: Which of the following is not depicted in the diagram?* O Okazaki fragment O Replication fork O…

A: The diagram is showing ongoing Replication. Replication is the process by which double stranded DNA…

Q: Which of the following steps in DNA replication would occur second? 1.DNA molecule separates into…

A: Replication occurs in three major steps: the opening of the double helix and separation of the DNA…

Q: ch of the following does not occur during DNA replication? t an answer and submit. For keyboard…

A: Ans - c

Q: In the process of DNA replication, there are four important enzymes. Construct a table, provide what…

A: DNA replication is semi conservative process involves process of producing two identical DNAs from…

Q: During the process of Gel Electrophoresis, DNA will move through the gel towards the-------end of…

A: DNA is the genetic material. It is responsible for regulating cell activities.

Q: Just prior to DNA replication the cytosine in the sequence GTTCATTG is deaminated and it is not…

A: The deamination means removal of the amino group (-NH2) from a particular molecule. In the cell…

Q: Using the following DNA sequence what would be the complementary DNA made during replication? TAC…

A: Complementary DNA is synthesized from a mature mRNA strand and it lacks both promoters and introns.…

Q: new DNA molecule is precisely synthesized during the following EXCEPT? A.Trasformation B.…

A: Nucleic acid is a long chainlike molecule composed of nucleotides found in cells of all living…

Q: DNA replication is called semi-conservative because ___ (all, all or none) of the two new strands of…

A: Replication is the process of formation of identical copies of DNA. It take place in nucleus. It…

Q: Reproduction of DNA Before DNA can copy itself the cell must make lots of extra A, T, G, and C. Then…

A: The process by which DNA is effectively doubled is known as DNA replication, also known as…

Q: Number the steps of DNA replication in the correct order (1, 2, 3) a) ______ Polymerase travels down…

A: Correct order is 1.)- b. 2.)-a. 3.)-c

Q: During DNA replication, the enzyme called _______ unwinds the DNA do

A: The helicase enzyme unwinds the DNA double strand helix by breaking the hydrogen bonds present…

Q: Which of the following statements is/are TRUE for DNA Replication? Two daughter DNAs are formed,…

A: DNA replication is a process by which 2 copies of DNA are produced from a DNA double helix using…

Q: DNA replication is said to be semiconservative because ___

A: DNA Replication is an integral part of the Central Dogma concept, which states that DNA makes RNA…

Q: Which of the following statements best explains the mechanism for DNA replication? DNA replication…

A: Ans-DNA replication is semi-conservative, because each DNA strand serves as a template during…

Q: S ..GACTAAGGCTTAGS CTGATieCGAATGS .CTGATTCCG AA TG 5 NEW STRANDS (Fill in the correct bases and…

A: DNA is the genetic material of a cell that carries hereditary information required for the survival…

Q: How is bacterial DNA replication different from eukaryotic DNA replication? Multiple Choice…

A: DNA replication is the process by which new DNA is synthesized from the old DNA. In other words it…

Q: Which of the following replication proteins is incorrectly paired with it’s function?

A: The DNA replication occurs with the action of many enzymes that ar having some unique functions.

Q: Before a cell that you are studying undergoes DNA replication, you replace all of the regular dCTP…

A: Dna replication follows the semi conservative approach ie when it divides the parent strands…

Q: Which of the following statements indicates the correct model and provides the appropriate…

A: DNA is the genetic material of almost all living organisms. It contains information that is passed…

Q: Which of the following is not a characteristic of DNA replication? The synthesis of a new DNA strand…

A: DNA replication is the process of synthesis of new strands of DNA from parental strands. The process…

Concept explainers

Viral Replication

The virus is acellular and considered non-living outside the host cell. The replication of the virus occurs only inside the living cells. Only a few genes are present in the smallest virus, whereas many genes are present in the largest virus. These genes encode specific viral proteins.

Question

DNA replication is considered semiconservative because _______.

Select one:

it will create a new identical strand to the template.

it can replicate from two directions (bidirectional) from the origin(s).

it uses one old strand as a template for the synthesis of a new strand.

it always replicates in the 5' to 3' direction.

Definition Definition Mechanism by which deoxyribonucleic acid (DNA) is capable of producing an exact copy of itself. DNA molecules utilize a semiconservative method for replication. DNA replication is the most essential part of biological inheritance and is crucial for cell division during growth and repair of damaged tissues.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

DNA replication is called semi-conservative because ___ (all, all or none) of the two new strands of DNA is old DNA from the original DNA molecule and ___ (all, all or none) is new DNA.
DNA replication begins on a double helix at specific sites, called origins of replication where DNA polymerases make the covalent bonds between the nucleotides of a new DNA strand and replication then proceeds in both directions. Select one: True False
Which of the following statements BEST describes the process of DNA Replication? Group of answer choices The two strands of the parental molecule separate and serves as template for synthesis of a new strand. Each new strand is identical to its template strand. Each strand of both daughter molecules contains a mixture of old and newly synthesized DNA. The two parental strands reassociate after acting as templates for new strands restoring the parental double helix.
. DNA polymerase II (in E. coli) is specialized for which of the following functions? DNA replication, DNA recombination, and DNA repair both DNA repair and DNA replication both DNA replication and DNA recombination DNA replication only DNA recombination only
Which of the following statements about DNA replication is FALSE? Select one: Unwinding of the DNA molecule occurs as hydrogen bonds break. The new strand of DNA is synthesized from 5’ to 3’ direction. Replication occurs as each base is paired with the same base. In eukaryotes, replication can occur at numerous replication bubbles, each with two forks.
Why is replication called semi-conservative? each new molecule of DNA contains one template strand and a newly synthesized one only some of the lagging strand is conserved all strands are conserved except for one strand not all leading strands are conserved
True or False: Polymerases open the DNA and create the replication bubble while helicases run towards the replication forks. The replication forks show the bidirectional replication of DNAs.
A DNA strand has the following sequence: 5’-GAACCCGATGGCGATACATTTACCAGATCACCAGC-3’ In which direction would DNA polymerase slide along this strand (from left to right or from right to left)? If this strand was used as a template by DNA polymerase, what would be the sequence of the newly made strand? Indicate the 5’ and 3’ ends of the newly made strand.
A scientist produces an unusual colony of E. coli, that have a mutation to a gene which alters the function of helicase. Which of the following would most likely be observed as a result of this mutation? Group of answer choices RNA polymerase would be unable to replicate DNA. Replication will require a DNA template from another source. No DNA proofreading will occur. No replication fork will be formed.
Which of the following replication proteins is incorrectly paired with it’s function? DNA polymerase - adds nucleotides to the growing strand Single stranded binding proteins - hold the DNA strands apart while they are being replicated Ligase - enhances separation of DNA strands Topoisomerase - relieves torsional stress due to unwinding by the DNA Primase - synthesizes a short RNA sequence to initiate replication
DNA replication is said to be semiconservative because ___ Synthesis can proceed uninterrupted (as a leading strand) in only one direction Each new DNA strand contains one parent strand and one new strand After each round of DNA replication, the original DNA strands joins None of the above
Which of the following steps in DNA replication would occur second? 1.DNA molecule separates into two template strands.2.Complimentary nucleotides are added to each template strand.3.DNA molecule unwinds.4.Two DNA molecules, each with a template strand and a new strand, are formed.