A new DNA strand elongates only in the 5' to 3' direction because _____. replication must progress toward the replication fork DNA polymerase begins adding nucleotides at the 5' end of the template DNA polymerase can add nucleotides only to the free 3' end the polarity of the DNA molecule prevents addition of nucleotides at the 3' end

Answer - Option C - DNA polymerase can add nucleotides only to the free 3' end

Answered: A new DNA strand elongates only in the…

Science

Biology

A new DNA strand elongates only in the 5' to 3' direction because _____.

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 20QP: What is the function of DNA polymerase? a. It degrades DNA in cells. b. It adds RNA nucleotides to a...

See similar textbooks

Related questions

Q: Given a part of DNA undergoing replication. Copy and write the corresponding bases in the new…

A: Semiconservative mode of DNA replication describes the mechanism of DNA replication in all living…

Q: Which of the following statements is true regarding DNA replication? Select all true statements. DA…

A: DNA replication is a process by which two identical copy of DNA is produced from single original DNA…

Q: Match the statement to the corresponding agent/key player in DNA replication. Some items require…

A: “Since you have posted a question with multiple sub-parts, we will solve first three sub-parts for…

Q: Separates DNA strands to expand the replication bubble. , DNA polymerase . Uses template strand to…

A: i)- Separates DNA strands to expand the replication bubble-Helicase ii)-Uses template strand to…

Q: Using the picture below, match each letter (A-E) to 5' or 3' DNA polymerase molecule Parental DNA…

A: As the options are not visible, we are answering the question based on the general principle of DNA…

Q: Match the statement to the corresponding agent/key player in DNA replication. Some items require…

A: DNA replication is the biological process where a double-stranded DNA molecule is copied or…

Q: Which of the following statements is false about DNA replication: a. Enzyme DNA polymerase opens the…

A: The process through which new identical copies of DNA are produced from the double-stranded DNA…

Q: Match each statements below with the appropriate letter from the replication fork diagram. 1.…

A: 1. Removal of RNA primers and joining of Okazaki fragments. Because of its 5′ to 3′ exonuclease…

Q: leading strand Primase begins RNA polymerization de novo. lagging strand DNA polymerase synthesizes…

A: The DNA replication starts with some enzymes that cut the strands from one side and attached them…

Q: Shown below is a double stranded DNA molecule.Replicate this DNA and show the products formed from…

A: DNA REPLICATION :- It is the process by which DNA makes a copy of itself during cell division. The…

Q: DIRECTION: SEQUENCING: PLACE THE STEPS OF DNA REPLICATION IN THE CORRECT ORDER a. DNA Polymerase…

A: Answer : the correct sequence is : 1- e. DNA helicase unwinds DNA 2- c. DNA polymerase attaches…

Q: DNA replication begins... A. At the origin of replication B. At the 5' end of the…

A: The transfer of genetic material from one generation to the other and during cell division is…

Q: 10

A: DNA replication is a process by which new copy of DNA molecules are made by DNA polymerase.

Q: Match the following descriptions with the enzymes involved in DNA replication. Adds an RNA primer…

A: Deoxyribonucleic acid commonly abbreviated as DNA is the genetic material in most eukaryotes. It is…

Q: Draw replication forks that show what you would expect to see if a cell were unable to make the…

A: Replication is the process of synthesis of new DNA strand from the existing ones. The existing DNA…

Q: What enzyme synthesizes small primers for DNA polymerase to bind to so it can initiate DNA…

A: DNA replication is the first process in the central dogma of life. It involves the synthesis of new…

Q: Label! Label! Practice: DNA Structure and Replication 1. Label cach part of the model to the right.…

A: DNA is a complex biomolecule that composed of Deoxyribose suger, phosphoric acid and nitrogen base.…

Q: Referring to the figure, what bases will be added as DNA replication proceeds on the bottom strand?…

A: Answer: REPLICATION: It is the step in the central dogma in which synthesis of DNA occured to form…

Q: Considering that DNA is synthesized in the 5' to 3' direction, which direction must DNA polymerase…

A: Introduction: Biological information is transferred from DNA to RNA and then to proteins. This is…

Q: Label the figure to assess your knowledge of DNA replication. Drag the appropriate labels to their…

A: The given diagram shows the replication of the DNA.The DNA replication can be defined as a process,…

Q: Which of the given enzymes is not involved during DNA replication on template with polarity 3' - 5'?…

A: DNA replication in eukaryotes is semiconservative, semicontinuous, and bidirectional. It occurs in…

Q: Match Column A with Column B. unwinds the two DNA strands at the replication A. DNA Gyrase fork B.…

A: DNA is the genetic material. In replication two copies of DNA are made.

Q: DNA Structure and Replication 2 3 4 10 11 12 13 14 15 16 17 19 Across DOwn 1 Enzyme that "glues"…

Q: DNA polymerases cannot initiate synthesis of a polynucleotide; they can only add nucleotides to the…

A: DNA is the genetic material in organisms. It is formed via polymerization of nitrogen base ,…

Q: A student mixes various molecule needed for DNA replication. When he adds DNA, replication occurs,…

A: DNA is a double helix structure that is made up of two anti-parallel strands of a polynucleotide…

Q: Why does DNA have a leading strand and a lagging strand during replication? Select the correct row…

A: Replication is the process of copying the DNA strands. It occurs through a series of events with…

Q: Show the replication strands in each of these bubbles (note they have different DNA orientations).…

A: DNA Replication Replication of DNA is a process of duplication of DNA, carried out by DNA…

Q: DNA replication starts with the helicase enzyme binding to the Select one: a. replication fork b.…

A: DNA replication is the process by which multiple copies of the DNA molecule is made. Before the…

Q: Below is a double stranded DNA molecule with a replication bubble. The filled lines represent the…

A: DNA replication refers to an enzyme-mediated complex process that produces replicate or copies of…

Q: Label the following diagram using the words from the word box below. You can write your answers in…

A: As per our company guideline we are supposed to answer only first question or first 3 subparts of…

Q: Polymerases work is to add 10 nucleotides to a DNA strand before dissociating. During replication…

A: The compounds known as nucleotides are made up of a nitrogenous base, a phosphate group, and a sugar…

Q: Click on your screen over the DNA polymerase III enzyme depicted on the lagging strand. Replication…

A: Introduction : DNA replication is the process through which daughter DNA is formed from parental…

Q: A researcher combines a variety of molecules needed for DNA replication. After adding DNA to the…

A: The correct option is (A) DNA ligase

Q: When DNA is copied (replicated), which of the following is NOT true? DNA polymerase adds nucleotides…

A: DNA polymerase binds at the TATAA site on the coding strand to initiate replication.

Q: Reproduction of DNA Before DNA can copy itself the cell must make lots of extra A, T, G, and C. Then…

A: The process by which DNA is effectively doubled is known as DNA replication, also known as…

Q: Number the steps of DNA replication in the correct order (1, 2, 3) a) ______ Polymerase travels down…

A: Correct order is 1.)- b. 2.)-a. 3.)-c

Q: Medgie is creating his science fair project on DNA replication. His final display board shows the…

A: The process of formation of other strands of DNA from parental DNA is called replication with the…

Q: Sequencing Number the steps of DNA replication in the correct order 1 being the first & 5 for the…

A: DNA is the genetic material .DNA replication ensure that new cell is receiving the correct number…

Q: This diagram shows the functions of different enzymes during DNA replication. Which label would…

A: Cells are the basic unit of life and life originated from nucleic acid according to several theories…

Q: The diagram below shows a DNA replication bubble. The circles indicate the origin of replication.…

A: Replication is the process of synthesis of new strand DNA from their parent strand. whereas…

Q: Match each DNA Replication enzymes on the left with its function I) DNA Ligase II) DNA Polymerase II…

A: Introduction The process by which a double-stranded DNA molecule is copied to produce two identical…

Q: Label the parts of the DNA replication fork. DNA ligase Leading strand Okazaki fragment DNA…

A: DNA replication, as used in molecular biology, is the biological method for creating two identical…

Q: DNA polymerase l moves toward the direction of replication fork creating Okazaki Fragments. * True…

A: Most living organisms that are well defined in terms of that they have DNA as their genetic…

Q: S ..GACTAAGGCTTAGS CTGATieCGAATGS .CTGATTCCG AA TG 5 NEW STRANDS (Fill in the correct bases and…

A: DNA is the genetic material of a cell that carries hereditary information required for the survival…

Q: How is bacterial DNA replication different from eukaryotic DNA replication? Multiple Choice…

A: DNA replication is the process by which new DNA is synthesized from the old DNA. In other words it…

Q: Replication 1. The replication origin is identified. 2. DNA primase builds RNA primer. 3. Okazaki…

A: The opening of the double helix and separation of the DNA strands, priming of the template strand,…

Q: Replication Bubbles When all of the bubbles have collided, two new strands of DNA have been made.…

A: DNA replication is the process by which a double stranded DNA molecule is copied to produce two…

Q: Place the following events of DNA replication in order 1. DNA strands separate 2. DNA polymerase…

A: For growth and development of a cell DNA replication is essential which will help to transfer the…

Q: Please match each protein with its role in DNA replication binds to the origin of replication 1.…

A: DNA replication is the biological process of copying the contents of DNA ie, forming two identical…

Concept explainers

Viral Replication

The virus is acellular and considered non-living outside the host cell. The replication of the virus occurs only inside the living cells. Only a few genes are present in the smallest virus, whereas many genes are present in the largest virus. These genes encode specific viral proteins.

Question

A new DNA strand elongates only in the 5' to 3' direction because _____.

		replication must progress toward the replication fork
		DNA polymerase begins adding nucleotides at the 5' end of the template
		DNA polymerase can add nucleotides only to the free 3' end
		the polarity of the DNA molecule prevents addition of nucleotides at the 3' end

Definition Definition A complex molecule that makes up a fundamental unit of a DNA or RNA molecule. Nucleotides are composed of a sugar, a nitrogenous base, and a phosphoric acid.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

What is the function of DNA polymerase? a. It degrades DNA in cells. b. It adds RNA nucleotides to a new strand. c. It coils DNA around histones to form chromosomes. d. It adds DNA nucleotides to a replicating strand. e. None of these.
Number the steps of DNA replication in the correct order (1, 2, 3) a) ______ Polymerase travels down the DNA parent strand b)______ DNA strands are unzipped c) ______ Ligase binds Okazaki fragments together
Given the replication events listed below which even takes place first Single Strand binding proteins bind Primase adds an RNA primer Helicase unwinds the DNA double helix DNA polymerase begins adding DNA nucleotides
The region of DNA, shown below, is being copied. Diagram what happens when the second GT repeat (newly synthesizing strand) slips out (loops out). Diagram what occurs in this and the next round of DNA replication. Describe the change in the DNA sequence that occurs due to this replication slippage. 5’TGCCAGTGTGT3’ACGGTCACACACACATGGAG5’
A scientist uses a molecule of DNA composed of radioactive nucleotides as a template for replication and transcription in a nonradioactive environment. a) What percentage of individual strands of DNA will be radioactive after three (3) DNA replication cycles? 2. b) What percentage of RNA will be radioactive?
The model of DNA below is ready to be copied. Compare to the original double helix, evaluate the copies made during three attempts of DNA replication. List any errors with the replication if they occurred.
Which of the following statements about DNA replication is correct? Group of answer choices the leading strand is replicated continuously, while the lagging strand is replicated discontinuously on the leading strand, the new nucleotides are added only to the 5' end of the nucleotide chain on the lagging strand, the new nucleotides are added only to the 5' end of the nucleotide chain DNA polymerase works from 3'--> 5' only
A drug that inhibits the DNAa protein is added to a culture of E. coli cells. What is the first step of DNA replication that will be impaired by this drug? Group of answer choices Keeping parent DNA strands separated Releasing tension generated by supercoiling Activating the origin of replication Making primers Forming phosphodiester bonds
Which of the following statements BEST describes the process of DNA Replication? Group of answer choices The two strands of the parental molecule separate and serves as template for synthesis of a new strand. Each new strand is identical to its template strand. Each strand of both daughter molecules contains a mixture of old and newly synthesized DNA. The two parental strands reassociate after acting as templates for new strands restoring the parental double helix.
Which of the following statements about DNA replication is FALSE? Select one: Unwinding of the DNA molecule occurs as hydrogen bonds break. The new strand of DNA is synthesized from 5’ to 3’ direction. Replication occurs as each base is paired with the same base. In eukaryotes, replication can occur at numerous replication bubbles, each with two forks.
Fill in the blanks in the paragraph about DNA replication. DNA replication begins at the ___________________ Eukaryotic cells have ______________ origins of replication to make the duplication of DNA ____________. Two _____________ are created as replication continues in both ______________ from this point. The replication fork is where _______________ is actively taking place. As replication continues, a ____________ is created. These bubble continue to grow until two ___________ have been formed.
A student mixes various molecule needed for DNA replication. When he adds DNA, replication occurs, but each DNA duplex consists of a normal DNA strand paired with numerous segments of DNA a few hundred nucleotides long. What has been left out of the mixture? A. NTPs B. DNA polymerase III C. ATP D. DNA polymerase I E. DNA ligase