Which of the following is true about DNA polymerase?a) It can synthesize DNA in the 5’ to 3’ directionb) It can synthesize DNA in the 3’ to 5’ directionc) It can synthesize mRNA in the 3’ to 5’ directiond) It can synthesize mRNA in the 5’ to 3’ direction

Which of the following mutations of the DNA sequence TTT TÁC ACT would potentially have the least effect on the protein containing the sequence? A) TTA TAC ACT B) TTT TTC TCT C) TTT TAC TGA D) TAA AAC AGA E) They would all have the same effect.

A single template strand of a DNA molecule is represented by  3’atgtaccatgcgcaaatttaaaggccc5’. a) Using the same strand above as a template, write the pre-mRNA transcript. b) List the molecules that must be present for DNA to be transcribed.  Briefly describe their function. c) What are three modifications that happen to pre-mRNA before it becomes mature mRNA

What type of damage does UV light do to DNA? a) It causes adjacent T bases to form a new bond which not always replicated properly b) It only causes nonsense mutations c) It directly deletes nucleotides d) It directly changes Cs to Gs C Listen In a particular genetic condition, the DNA is changed from 5' GTC3' to 5' GGC 3' The end result of the mutation will be a (use the codon table below) UUU UUC Phe UUG} Leu CUU CUC CUA CUG AUU AUC AUA AUG GUU GUC GUA GUG } Leu lle Met Val a) Frameshift Mutation b) Silent Substitution. c) Missense Mutation. d) Nonsense Mutation UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala UAC}Tyr UAA UAG Stop CAU CAC CAA CAG AAU AAC AAA AAG } GAU GAC GAA GAG} His Gln Asn Lys Asp Glu UGU UGC UGA UGG CGU CGC CGA CGG AGU AGC AGA AGG GGU GGC GGA GGG Cys Stop Trp Arg Ser Arg Gly