Q: 5) cranial nerve II, the optic nerve sends nerve impulses to the brain carrying information about…
A: It is critical to learn and know the anatomy and physiology of the human body. Many changes in the…
Q: Climate change, water and politics are 3 of the 10 fundamental environmental issues. Select one: O…
A: Earth is currently facing a lot of environmental concerns. The environmental problems like global…
Q: The distinction between SLA and HDD may be explained as follows:
A: Disease It is a particular abnormal condition that negativity affects the structure or function of…
Q: estrogen receptor (ER)-positive or -negative.
A: Cancer : The condition where the cells in a specific part of the body grow and reproduce…
Q: 9. Explain how a small amount of growth factor can mediate an amplified signal inside the cytoplasm…
A: Signal transduction pathways translate signals received at the cell's surface into cellular…
Q: Which theory of aging states that unstable oxygen molecules tend to steal electrons as they bounce…
A: The unstable oxygen molecules have higher energy and can damage the biomolecules.
Q: If an antisense RNA is designed to silence the following mRNA sequence, which of the following…
A: mRNA sequence:-5' UAGGACUAUUAAGGUACACCCAUU 3' to silence this sequence the antisense RNA should be…
Q: What are the physiological changes that can occur when an individual adds resistance training to…
A: Introduction Resistance training is any exercise that causes the muscles to contract against an…
Q: Explain how viruses differ from living organisms.
A: A virus is an infectious microorganism made up of a nucleic acid segment (DNA or RNA) that is…
Q: SARS-CoV-2 was shown to be transmissible even when the carrier has no symptoms. How did this…
A: SARS virus is a positive strand RNA virus and belongs to coronavirus family.
Q: Which types of macromolecules (protein, carbohydrate, fat, or nucleic acid?) can be enzymatically…
A: Digestion is accomplished by mechanical and chemical processes. Enzymes aid in chemical digestion.…
Q: A worker spends 16 hours per week for 10 weeks in an area with 1.2 WL of radon daughters. a) What is…
A: Radon daughters enter the body with the inhaled air. The alpha particle dose to the lungs depends on…
Q: Gene A encodes for a protein A which prevents exit from the G1 phase of the cell cycle. You are…
A: Cancer is the uncontrolled cell division that is highly under the control of genes. Cell cycle is a…
Q: Solve in digital format to be able to pass it to word Look at the following scheme: why we say that…
A: Metabolism is defined as the entire quantity of biochemical events that occur in an organism's cells…
Q: A __________ is the form of collective behavior that hasthe most structure, lasts the longest, and…
A: Common forms of collective behavior discussed in this section include crowds mobs panics riots…
Q: 10. Ꮽ 11, 5
A: Introduction The ovary is a female reproductive system organ that contains multiple eggs (Ovum).…
Q: what is the difference between DNA microarray and Fluorescence in situ technique? or is the…
A: Difference between FISH and Microarray Technique Fluorescence In Situ Hybridization It is possible…
Q: Which of the following are recommendations for dietary fat intake in athletes? Check all that apply.…
A: Option 1 is correct . Athletes should consume 20 to 35 percent of their calories from fat. Option 2…
Q: Question z Methanogens are always engaged in relationships with other microbes because methane…
A: Answer- interspecies hydrogen Transfer. Interspecies hydrogen transfer (IHT) is a form of…
Q: Which of the following signs is most often observed in acute and chronic alcoholism? OA. Barret…
A: Alcohol poisoning is a condition caused by the rapid and excessive consumption of alcoholic…
Q: ATP synthase is a protein that catalyzes the formation of the energy storage molecule adenosine…
A: Given: ATP synthase is the protein that catalyzes the formation of the energy storage molecule…
Q: Explain what happens to urine flow rate, specific gravity and urinary excretion of chloride in each…
A: As it is mentioned in the question the intake is isotonic that means the osmolarity of the intake…
Q: 1. Explain the functioning and regulation of the following operons: lac, trp. 2. Explain the…
A: Every organism have various charcyerstics why may or may not be similiar to each individual. Tgese…
Q: Identify four important factors in achieving efficient heat exchange in milk processin
A: Milk processing refers to the process of collecting milk from cattle, pasteurising, clarifying,…
Q: If you cloned GFP under the control of the V. fischeri Lux promoter, when would you see GFP…
A: Vibrio fischeri exhibits bioluminescence only when the density of its cell is higher and…
Q: which protein consists mainly of a helixes a. hemoglobin d collagen b cotton e…
A: The structure of proteins is organized at four levels. The primary structure shows the sequence of…
Q: Change in gene frequencies within a reproductive population is called: O allopatric speciation. O…
A: Evolution is defined as a change in the inheritable traits of biological populations, over multiple…
Q: design a bacterial/archaeal species, what would be its characteristics (e.g. shape, arrangement,…
A: Bacteria are small unicellular microorganism that lacks any proper cell organization (which means no…
Q: The form of oxygen found toxic to microorganisms is rendered non-toxic by a. Superoxidase which…
A: Superoxide is composed of highly reactive oxygen atoms. It has the ability to reduce metal ions and…
Q: Lungfishes Amphibians Mammals Tetrapod limbs Lizards and snakes Amnion Crocodiles Ostriches Feathers…
A: In biology, evolution refers to the change in a species' features over numerous generations as a…
Q: QUESTION 7 SR proteins bind to splicing enhancers and activate splicing by recruiting spliceosome…
A: SR proteins hepls in pre mRNA splicing. SR protein has two binding domain. RNA recognition motif…
Q: Protein P, normally stimulates apoptosis or cell death when activated. Consider a cell with a…
A: The construction of this question gives us an information about the nature of protein P, P when…
Q: Metabolic syndrome is a clustering of various conditions including high blood pressure, high blood…
A: Answer :- Option (C) is correct. - Insulin receptor phosphorylation increases insulin secretion.
Q: Give a specific example on how to use UV-Vis spectrophotometer in Cosmetic Science. Provide a…
A: The UV/Vis spectrophotometer is thermo Scientific Multiskan SkyHigh Microplate Spectrophotometer.…
Q: Complete the table. Calculate the size of a theoretical population of E. Coli, if given unlimited…
A: The generation time of the given bacteria Escherichia coli is 20 minutes. This means that every 20…
Q: Yeast cells has been cultured on glucose (Table 1). The growth data follows the Monod Equation Table…
A: I gave you the answers below. Thank you.
Q: You are working with a bacterial lysogen and have decided to induce lysis. What needs to happen for…
A: Viruses are an obligate intracellular parasites. Some viruses are temperate phages that have to…
Q: 1. Bioinformatics analyses of the genomes of cancer cells from many different patients with…
A: Introduction Cancer is a disease in which some cells in the body grow out of control and spread to…
Q: Dinitrophenol (DNP) is a lipid soluble H+ binding drug that equalizes the H+ concentration across…
A: dinitrophenol is essentially an organic molecule with the formula HOC6H3(NO2)2. It's a pleasant,…
Q: Which is most important in catalysis of peptidyl transfer? A Massively parallel sequencing data…
A: Peptidyl transferase is used in the process of translation where protein is synthesized. Proteins…
Q: Compare and contrast the adaptive structures of the insect ectoparasites and the endoparasites.…
A: Ectoparasites are organisms that live just on skin of humans and other animals and are classified as…
Q: why a mutant Ras is an oncogene causing many human cancers
A: Ras proteins are proto-oncogenes that are frequently mutated in human cancers.
Q: cycle was thể first etabolic cycle to be Vered, predating the description of the citric cle by 5…
A: Urea cycle began inside the mitochondria of liver hepatocytes but three of the steps occur in the…
Q: Do the following mathematical calculations to figure out the work each hand did: Work = 1…
A: Introduction The relationship between two versions of a gene is referred to as dominant. Each parent…
Q: A researcher studied 6 independently assorting genes in a plant. Each gene has a dominant and a…
A: Given: Dominant allele Recessive allele R- Black stem r- red stem D- tall plant d- dwarf…
Q: ANSWER THE SAME ANSWER ANYMORE. PLEASE INCLUDE REFERENCES I NEED IT. MAKE IT DETAILED IN ONE…
A: Endometrial polyp is abnormal growth after menopause in uterus. But also present unusually in young…
Q: If a person has one gene influencing blue eyes but actually has brown eyes, blue eyes must be a…
A: Introduction :- When two or more genes control the same trait, it is known as polygenic inheritance.…
Q: The titer of Lauren's phage is 3.7 X 108 pfu/mL. She diluted her phage lysate 1:10 from 10° to 10-7…
A:
Q: If the G locus were 50 or more map units from the centromere, what types and proportions of gametes…
A: Introduction Recombination:- It is a process by which pieces of DNA are broken and recombined to…
Q: What is diabetes mellitus? Differentiate between Type I and type II diabetes
A: Introduction :- A condition in which the body's glucose (a type of sugar) levels are out of control…
does chain abberation due to translocation mutation result to fertile gametes?
Step by step
Solved in 3 steps
- An individual is heterozygous for a reciprocal translocation, with the following chromosomes: A • B C D E F A • B C V W X R ST • U D E F R ST • U V W X Q. Draw a picture of these chromosomes pairing in prophase I of meiosis.Which is the type ofgamete produced by aheterozygous individual?What is the genotypicalproportion of these gametes?An individual is heterozygous for a reciprocal translocation, with the following chromosomes: A • B C D E F A • B C V W X R ST • U D E F R ST • U V W X Q. Explain why the fertility of this individual is likely to be less than the fertility of an individual without a translocation.