Down Below is a concept map that connects the digestive, circulatory, and respiratory system. Add more pictures and information on how they connect ON THE CONCEPT MAP freeMind MapThe respiratory and circulatorysystems circulate blood and oxygenAirir moves through the trachea andbronchipharynxlarynxTracheaBronchiI Q &Respiratory system body parts includenosemouthBRONCHIRespiratory systemTracheaPrimary bronchiThe circulatory system includes:Calified bonesBloodWBCRBCHearteTertiary bronchiBodyCirculatory systemVesselsArteriesRBCMOUTH(carried oxygenated blood)Digestive systemWorks to absorb nutrients andcarry chemical signals.It body parts includeMouthEsophagusLiverGall bladderPancreasLarge intestineSmall intestineVeins(carriedd deoxygenated blood)AppendixRectumAnusThe nasal passages open into the pharynx, which is common for therespiratory and digestive systems.When we eat food mixed with gastric juicesThe teeth crush the food and mix it with salivaIn the stomach, food mixes with gastric juicesNutrients are absorbed in the small intestineThe liver will produce bile that breaks down thefoodFeces Pass through the rectum and leave thebody through the anus.ovulaTonsilTongueMouthLIVERLeft lobeEsophagusRightlobeGall bladdeStomachlarge intestineSmall intestineAnus0+TAILBODYAPANCREASMDUODENUM[1

Concept maps are done to depict the mechanisms of the different organ systems of the body. It is…

Answered: Down Below is a concept map that…

Down Below is a concept map that connects the digestive, circulatory, and respiratory system. Add more pictures and information on how they connect ON THE CONCEPT MAP

Body Structures & Functions Updated

13th Edition

ISBN:9780357191606

Author:Scott

Publisher:Scott

Chapter17: Respiratory System

Section: Chapter Questions

Problem 1ATC

See similar textbooks

Related questions

Q: BIOLOGY ACTIVITY -Gene Mutations and Proteins Objective: To demonstrate how gene mutations affect…

A: Protein Sequence from Step 3: Leu-Thr-Cys-Val-Arg-Gly...Protein Sequence from Step 4 (with the fifth…

Q: What role can advancements in forensic biology play in the investigation and resolution of criminal…

A: Forensic biology is a sub-discipline of forensic science that focuses on the application of…

Q: A population of bats in a local zoo demonstrates geometric growth. The initial population size is 43…

A: Geometric growth is way of increasing population size at foxed intervals and constant rate.

Q: Please do not give solution in image format thanku Critique the following definition of ecology:…

A: In 1866, a German naturalist by the name of Ernst Haeckel published a book titled "Generelle…

Q: purple flowering, smooth seed dihybrid plant (genotype PpSs) is test crossed with a white flowering,…

A: Dihybrid cross is the cross in which two characters are involved. Its ratio is different when the…

Q: Create a dichotomous key using the genera/species: Mycale laxissima, Halichondria poa, Amphimedon…

A: A dichotomous key is a tool used in taxonomy and biological classification to identify and classify…

Q: what is the name of the stage between cell division called?

A: Interphase is the stage between cell divisions where the cell grows, carries out its functions, and…

Q: The coefficient of relatedness for the population of Great Brittan is 0.015. What is the risk of…

A: The degree of consanguinity (or biological relationship) between two people is measured by the…

Q: What is the bacteriological standard for drinking water in the Philippines?

A: Water is a basic human requirement. Essentially, it is used for drinking, food cooking and…

Q: Coral reefs and algal beds Tropical wet forest Wetlands Tropical dry forest Temperate evergreen…

A: Biomass refers to the total mass of living organisms or organic matter in a given area or ecosystem.…

Q: A mixture of amino acid lysine, alanine, aspartic acid is subjected to an anionic exchanger…

A: In anion exchange chromatography, molecules can be separated based on their charge properties. It is…

Q: 1) Research one major advance in cellular biology. In a short report (1-2 pages):< Describe how new…

A: Cellular biology deals with the understanding of various biological or cellular processes in order…

Q: What is an open-reading frame? a) An unknown gene b) The protein-encoding sequence of a gene c) A…

A: ORFs are commonly found within genes, which are segments of DNA that contain the instructions for…

Q: Which of the following are examples of how plants can either benefit or fool herbivores or…

A: 1- A flower produces nectar to attract bees.The flowers which are pollinated by insects are bright…

Q: What Philippine foods are similar to tempeh?

A: Tempeh, also known as tempe, has grown in popularity over the past 10 to 15 years, particularly…

Q: Match the term with the correct definition energetic hypothesis food chain bottom-up control food…

A: Ecology is the science that deals with the study of organisms, their interaction with other…

Q: Explain ; Chemoreceptors Stretch receptors Thermoreceptors

A: Sensory receptors are trained to recognise specific types of stimuli. They transform the stimulus…

Q: Please expound your answer. If you'll write, please do it legibly and clearly. Thank you. Explain…

A: Friedrich Wohler, a German scientist, accidentally created urea in the lab by employing the…

Q: The most abundant intracellular cation is/ are a. Na+ b. cytosolic Ca+ c. H+ d. K+ e.…

A: Ions are necessary for cellular activity. They participate in a wide range of crucial physiological…

Q: Ryanodine Receptor (RyR) SERCA (SR Ca2+ ATPase) Voltage-gated Na+ channels Actin Myosin…

A: The excitation-contraction coupling process refers to the sequence of events that links the…

Q: Some antibacterial drugs interrupt lipid A biosynthesis. What type of bacteria would these drugs…

A: Antibacterial drugs are the medications which are prescribed by doctors to slow the growth or…

Q: the Phospholipid bilayer below to diagram what steps occur during both the Photosystem 1 and 2. ke…

A: Photosynthesis is a process by which green plants prepare their own food with the help of carbon…

Q: In your own words explain the term “phagocytosis” and discuss the three (3) stages that are…

A: The immune response is a complex physiological process in which the body defends itself against…

Q: Give typing answer with explanation and conclusion Consider this claim: Changes in environmental…

A: The relationship between environmental conditions and ecosystems, as well as their impact on…

Q: Bacteriophage P22 was used in generalised transduction experiments to infect the Salmonella…

A: The horizontal transfer of the genetic material from donor bacteria to the recipient bacteria via…

Q: Examining Table 20-4, what do you think would be the order of mutations fixed during selection in a…

A: The frequent frequency of non-synonymous to synonymous substitution in coding regions, a…

Q: Question 6 Which of the following is/are necessary for natural selection to occur in a population of…

A: Natural selection is a fundamental mechanism of evolution that drives the adaptation of populations…

Q: u have two pieces of DNA, one contains 25% GC base pairs and the other has 60% GC. Which has a lower…

A: DNA is a polymer which is made up of a single monomer called a nucleotide. A nucleotide consist of a…

Q: Which statement describes the role of the organism indicated by the blue arrow in the food web large…

A: This question asks about the role and position of a particular organism in a food web.A food web is…

Q: QUESTION 5 5.1 Outline the disorders associated with the reduction of platelets, and the possible…

A: Thrombocytopenia refers to a condition characterized by a reduced number of platelets in the blood.…

Q: Your heart is a single organ, but it acts as a double pump in the human body explain this important…

A: Human circulatory system also called the blood vascular system consists of a muscular chambered…

Q: What specific biological evidence from a crime scene can be used to determine the approximate time…

A: The process of determining the time of death in forensic science is known as post-mortem interval…

Q: Species C: ATGTTCGCCGACCGCTGACTATTCTCTACAAACCACAAAGATATTGGAACACTATACCTA…

A: By submitting your query sequence to the chosen database, do a BLASTn search. By comparing your…

Q: One of the challenges of studying RNA is the rapid degeneration of RNA. While the half-life of mRNA…

A: A rod-shaped, Gram-negative, facultative anaerobic coliform bacteria of the genus Escherichia,…

Q: What is the advantage of using the MPN technique in the bacteriological analysis of water?

A: MPN full form, most probable number, is a method used in Microbiology for the…

Q: How many ATP (net) are made in the glycolysis part of cellular respiration? How many ATP are made in…

A: The complete oxidation of glucose to yield ATP is referred to as cellular-respiration. There are…

Q: Calculate the value of colour index of the examined blood if the amount of hemoglobin makes 140g/l,…

A: Red blood cells are responsible for the transport of oxygen to all the cells in the body. It is the…

Q: Give only typing answer with explanation and conclusion The expected phenotype ratio in the F2…

A: Alleles are the alternative firms of a gene that are located on the same locus of a homologous…

Q: neisseria gonorrhoeae attached to the mucosal epithelium and causes infection by phagocytosis lysis…

A: Neisseria gonorrhoeae, the bacterium responsible for gonorrhea, initiates infection by interacting…

Q: 7. Which of the following events does NOT take place in/on the RER? a. cleavage of the signal…

A: The question you provided focuses on events that occur in or on the endoplasmic reticulum (ER). The…

Q: A study was conducted to determine the importance of Nucleoid Associated Proteins (NAPs) by deleting…

A: 1- Nucleoid-associated protein (NAPs): These are small DNA binding proteins which can alter the DNA…

Q: A molecule that is oxidized... a) captures light energy Ob) accepts electrons Oc) reacts only with…

A: Oxidation is a chemical process in which involves the loss of electrons from a substance. A…

Q: What role do microbial symbionts play in shaping the ecological interactions between plants and…

A: Microbial symbionts are microscopic organisms, such as bacteria, fungi, and viruses, that maintain a…

Q: A keystone species is not necessarily abundant in a community but has a large impact on surrounding…

A: The concept of keystone species was introduced by ecologist Robert Paine in the 1960s.Keystone…

Q: Describe the dialysate solutions used in both procedures.

A: Dialysate solution are called as dialysis fluid. This is a type of solution of pure water,…

Q: Enhancers promoters changing transcription potential insulator sequence translation distant the same…

A: 1. Enhancers can regulate genes from a distance, and yet they influence expression of only some…

Q: 1) What type of organisms can carry out photosynthesis?

A: As, the question carries multiple sub questions inside, we have answered the first one for you.…

Q: 2. Consider the following reaction. What is the consequence of the increase of cytosolic CAMP…

A: During "fight or flight" response, heart rate and blood pressure increases. This means breathing…

Q: Scrotum: -The the scrotum is a each sac.(DiGiuseppe, M., & Adam-Carr, C. (2012). -located inferior…

A: The scrotum is a part of the male reproductive system. It is a pouch-like structure located behind…

Q: The population of individuals is growing at a continuous rate. The maximum growth rate is 0.35 and…

A: In this case, information is provided on a population of people that is continuously expanding. The…

Question

Down Below is a concept map that connects the digestive, circulatory, and respiratory system. Add more pictures and information on how they connect ON THE CONCEPT MAP

free
Mind Map
The respiratory and circulatory
systems circulate blood and oxygen
Air
ir moves through the trachea and
bronchi
pharynx
larynx
Trachea
Bronchi
I Q &
Respiratory system body parts include
nose
mouth
BRONCHI
Respiratory system
Trachea
Primary bronchi
The circulatory system includes:
Calified bones
Blood
WBC
RBC
Hearte
Tertiary bronchi
Body
Circulatory system
Vessels
Arteries
RBC
MOUTH
(carried oxygenated blood)
Digestive system
Works to absorb nutrients and
carry chemical signals.
It body parts include
Mouth
Esophagus
Liver
Gall bladder
Pancreas
Large intestine
Small intestine
Veins
(carriedd deoxygenated blood)
Appendix
Rectum
Anus
The nasal passages open into the pharynx, which is common for the
respiratory and digestive systems.
When we eat food mixed with gastric juices
The teeth crush the food and mix it with saliva
In the stomach, food mixes with gastric juices
Nutrients are absorbed in the small intestine
The liver will produce bile that breaks down the
food
Feces Pass through the rectum and leave the
body through the anus.
ovula
Tonsil
Tongue
Mouth
LIVER
Left lobe
Esophagus
Right
lobe
Gall bladde
Stomach
large intestine
Small intestine
Anus
0+
TAIL
BODY
A
PANCREAS
M
DUODENUM
[
1

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1: Biology Concept Map:

VIEW

Step 2: Connection between digestive, respiratory, and circulatory system:

VIEW

Step 3: Concept Map:

VIEW

Solution

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 4 steps with 1 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Alveoli is related to which of thefollowing system of human body?A. Circulatory systemB. Excretory systemC. Reproductive systemD. Respiratory system
*Respiratory SystemThe respiratory system functions in the exchange of gases between the external and internalenvironments. Major parts of the system include the nasal cavity, larynx, trachea, bronchi, and pulmonaryalveoli. Some regions of the respiratory system are specialized for the conduction of gases and other areasfunction primarily in the exchange of gases. Filtration mechanisms exist in both regions. The function ofeach part of the respiratory system is reflected in the structure of its wall: the type of epithelium and itsapical modifications, intraepithelial and subepithelial glands, cartilaginous rings and plates, smoothmuscle and elastic tissue, and the relationship of capillary endothelium to alveolar epithelium.Study the Respiratory system in Slide Box and Respiratory system under EM. QUESTION: What is the distinctive structural component of the wall of the trachea?
EVOLUTION CONNECTION One opponent of the moviemonster Godzilla is Mothra, a mothlike creature with awingspan of several dozen meters. The largest known insectswere Paleozoic dragonflies with half-meter wingspans. Focusingon respiration and gas exchange, explain why giant insects areimprobable.
Discuss what effect insuffi cient expiration might have onoverall homeostasis.
Watch this video (http://openstaxcollege.org/l/oxyblood) to see the transport of oxygen from the lungs tothe tissues. Why is oxygenated blood bright red, whereasdeoxygenated blood tends to be more of a purple color?
Evolution Connection Lizards and snakes cannotbreathe while chewing food because the connection betweentheir external nostrils and their esophagus is in the mouth.In contrast, mammals can continue breathing throughthe nostrils while chewing food in the mouth. However,choking sometimes occurs when the paths of air and foodcross each other. Thinking about the high oxygen demandof active endotherms, explain how the concept of descentwith modification explains this “imperfect” anatomy of someamniotes (see Figure 34.2 to review vertebrate phylogeny).
Trachea do not collapse when there is not much air because they are –a) thick and muscularb) having cartilaginous ringsc) Have valvesd) supported by larynx.
In respiratory System in insects (air-dried insect and whole mount of insect spiracle and trachea) determine the: the body segments where spiracles are found shape of the trachea
Air is pulled into the human respiratory tract mainly because ofvolume changes in thea. nose. c. chest cavity.b. pharynx. d. trachea.
Figure 39.7 Which of the following statements about the mammalian respiratory system is false? When we breathe in, air travels from the pharynx to the trachea. The bronchioles branch into bronchi. Alveolar ducts connect to alveolar sacs. Gas exchange between the lung and blood takes place in the alveolus.
A section of the lung that receives its own tertiary bronchus is called the ________. bronchopulmonary segment pulmonary lob tile interpulmonary segment respiratory segment
Watch this video (http://openstaxcollege.org/l/oxyblood) to see the transport of oxygen from the lungs to the tissues. Why is oxygenated blood bright red, whereas deoxygenated blood tends to be more of a purple color?