7. Which of the following events does NOT take place in/on the RER? a. cleavage of the signal recognition peptide b. biosynthesis of core oligosaccharides for N-linked glycosylation c. Phosphorylation of mannose to give rise to mannose-6-phosphate. d. attachment of a core oligosaccharide to protein via asparagine residues e. cleavage of GTP by SRP receptor

7. Which of the following events does NOT take place in/on the RER? a. cleavage of the signal recognition peptide b. biosynthesis of core oligosaccharides for N-linked glycosylation c. Phosphorylation of mannose to give rise to mannose-6-phosphate. d. attachment of a core oligosaccharide to protein via asparagine residues e. cleavage of GTP by SRP receptor

Name: 7. Which of the following events does NOT take place in/on the RER?a.
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 7. Which of the following events does NOT take place in/on the RER?a. cleavage of the signal recognition peptide b. biosynthesis of core oligosaccharides for N-linked glycosylation c. Phosphorylation of mannose to give rise to mannose-6-phosphate. d.

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter15: From Dna To Protein

Section: Chapter Questions

Problem 5TYK: Which of the following statements is false? a. GTP is an energy source during various stages of...

See similar textbooks

Similar questions

6. Where do the phosphate groups come from that are added to the proteins during phosphorylation? a. What are the enzymes called that perform phosphorylation? 7. In the diagram, identify the steps that represent reception (a), transduction (b), and response (c) in the phosphorylation pathway. 8. Phosphatases are enzymes that remove phosphate groups from proteins. Can you imagine a role for these enzymes in the signal transduction process? In other words, what would happen if the activated proteins continued to be active for a long period of time?
1. a)how is it possible for such drugs to selectively kill bacterial cells and not our own cells? b)Provide an example of post-translational regulation of protein activity and explain the advantage of regulating each protein/process at the post-translational level instead of the transcriptional level.
1. What happen to the mutated sequence in the coding region of MT-ATP6 in Leigh's syndrome. Does it lead to amino acids substitution? Illustrate the process
Which of the following statements is false? a. GTP is an energy source during various stages of translation. b. In the ribosome, peptidyl transferase catalyzes peptide bondformation between amino acids. c. When the mRNA code UAA reaches the ribosome, there isno tRNA to bind to it. d. A long polypeptide is cut off the tRNA in the A site so its Metamino acid links to the amino acid in the P site. e. Forty-two amino acids of a protein are encoded by 126nucleotides of the mRNA.
19. What statement is correct regarding the synthesis of actin monomers? a) They would be synthesized on free ribosomes, with a mitochondrial localization sequence that would be recognized by a receptor on the mitochondrial membrane. b) They would be synthesized on free ribosomes, with a nuclear localization sequence that would facilitate its passage through a nuclear pore. c) They would be synthesized on free ribosomes, with no signal sequence. d) They would have a signal sequence on its N terminus that would be recognized by a signal recognition particle (SRP) in the cytoplasm that would dock it on the endoplasmic reticulum. e) They would be synthesized in the endoplasmic reticulum, processed in the Golgi and sent to the nucleus in appropriated tagged vesicles.
What signal does the chaperone-mediated autophagy pathway of protein degradation use to identify proteins for destruction? a)The amino acid sequence KFERQ b)HSP90 c)The presence of ubiquitin groups d)The amino acid sequence PEST
3). Which of the following conditions leads to maximal expression of the lac greron? A. lactose absent, glucose absent B. lactose present, glucose absent C. lactose absent, glucose present D. lactose present, glucose present
Which statements decribe the function of the protein encoded by this gene CAGATTGTGAAGAGGTCTCTTGA? A. Break point cluster region protein that may function as a GTPase B. A coagulation factor C. An enzyme involved in the breakdown of glycosaminoglycans (GAGs) D. Transcription factor involved in the DNA damage response E. A component of hemoglobin F. A tyrosine kinase G. Serine/threonine kinase involved in the DNA damage response H. A tumor suppressor involved in WNT signalling I. A DNA repair enzyme involved in nucleotide excision repair
1. What cellular event happens in response to the binding of a growth factor to its respective receptor on the membrane of the growth factor’s target cell? Describe what happens to a tyrosine kinase receptor once it binds the growth factor signal. 2. Describe the three domains of a receptor tyrosine kinase. Explain the structure of the transmembrane domain and the amino acid composition and arrangement of this part of the receptor PLEASE ANSWER BOTH
7. A segment of a DNA strand consists of ...GCTTAGACCTGA.... (a) Identify the expected nucleotide order in the complementary mRNA (b) Identify the sequence of amino acids coded for by this segment of DNA. (c) Describe the bond that forms during translation to link amino acids together. Identify the functional groups that react and the atoms involved.
7) Please propose a mechanism that may link the increased abundance of unfolded proteins(perhaps due to elevated temperatures) with increased ability of the cell to facilitateprotein folding. The mechanism should involve a sequence of multiple events.
21. Which of the following is NOT a function/ property of the Signal Recognition Particle a. transfer protein across the ER membrane b. bind to SRP receptor c. bind to the signal sequence d. interrupt protein translation e. dissociate from the ER upon hydrolysis of GTP.