DNA TAC - GGC - GAA - TCC - CCA - GTA - TCC - ATT ТСС - ТСС - АTT (gene) MRNA AUG Amino Acid Met Sequence

Q: Transcribe the given DNA sequences to mRNA. DNA: 5'-GATCCGC-3' DNA: 5'-TTACGCTAA-3' DNA:…

A: INTRODUCTION The DNA and it's corresponding mRNA is given below.

Q: Below is a list of functions related to protein synthesis. Place the number for the function in the…

A: The production of RNA from the DNA is known as the transcription process that occurs within the…

Q: Describe the process of protein synthesis and localize where each step takes place. Use the…

A: Protein synthesis is one of the major processes, which helps in the synthesis of protein for the…

Q: If a scientist synthesizes a DNA molecule with a nucleotide base sequence to TACGGGGGAGGGGGAGGGGGA…

A: There are 4 nitrogen bases present in DNA, these are Adenine, Thymine, Cytosine, and Guanine.…

Q: If the DNA gene reads AAT GGT CCA CCG CTG, what will the MRNA read? O A. TTA CCA GGT GGC GAC O B.…

A: DNA is a macromolecule and is composed of nucleotides having sugar , phosphate and nitrogenous bases…

Q: Explain the process translation. A complete answer will include the words below tRNA, amino acid,…

A: The translation is the process of amino acid change of protein synthesis from the mRNA sequence. The…

Q: Use one of the vocabulary words to fill in the blank. Check your spelling. Key Vocabulary from Unit…

A: The ribosome is a special organelle in the cell that is responsible for protein production. The…

Q: During translation, a peptide is PRODUCED , while the MRNA is READ N-->C, 3-->5' 5'-->3'; N-->C.…

A: ANSWER;- N'-- C; 5'--3';

Q: de, translate the mRNA into an amino acid sequence.

A: Translation: It is the process by which sequence mRNA get translated into the sequence of amino acid…

Q: describe the process of reading a gene and turning it into a protein in a eukaryote.Your first…

A: Transcription: The process of conversion of segment of the DNA to RNA is called as Transcription.…

Q: Describe the process of transcription in as much detail as possible using pictures and words…

A: Note- According to the guidelines only one question can be answered at a time. Hence, one question…

Q: A DNA sense strand contains the following nucleotide base sequence: TAC AGC AAT CAC From this,…

A: Sense strand is a coding strand that does not code for mRNA.  Complementary base pairing occurs in…

Q: The sequence below is an mRNA strand that is in the cytoplasm ready to translated by a ribosome. If…

A: Translation is the process of formation of a protein chain from a RNA chain. Translation requires an…

Q: Select the most complete list of correct structures involved in the process of transcription…

A: Transcription is a process involved in the expression of a gene that takes place in the nucleus of a…

Q: Convert the DNA template to mRNA. Then, convert the mRNA to tRNA. Based from the resulting sequence…

A: Introduction :- The proteins are synthesized with the help of protein synthesizing machinery which…

Q: Which type of RNA is used as a template to build protein during translation? MRNA rRNA tRNA SİRNA

A: RNA or Ribonucleic acid is a type of Nucleic acid and is one stranded structure that is synthesized…

Q: If the sequence of the coding strand in a transcription unit is written as follows: 5'-…

A: In that question we have to write down the sequence of mRNA.

Q: mRNA binds to a ribosome. Transcription completes. mRNA leaves the nucleus. tRNA attaches to the…

A: Translation is a process which means Protein synthesis And prior to this Transcription completes in…

Q: mRNA binds to a ribosome. Transcription completes. mRNA leaves the nucleus. tRNA attaches to the…

A: DNA translation is the term used to portray the course of protein synthesis by ribosomes in the…

Q: Complete the phrases with the correct word or words. The task is to match the lettered items with…

A: Genes are sets of nucleotides that codes for a particular protein. The genes have to be expressed…

Q: A segment of a protein-encoding gene sequence is given below. 5'-AAGTTTGGCACT-3' 3'-TTCAAACCGTGA-5'…

A: Translation or protein synthesis is a process in which the genetic information present in m-RNA in…

Q: Draw/Diagram how translation starts at the N-terminus of a protein. Include the ribosome and label…

A: It is the process of the formation of proteins by the process of Translation. The proteins are…

Q: Examine the diagram below. At which times is translation but occurring? Production of a Particular…

A: The translation of the information contained in a mRNA (messenger ribonucleic acid) into an amino…

Q: Which amino acid sequence is coded for by the mRNA segment AUG-CCC-CAC-GAA-UAC? Met-Pro-Gin-Asp-STOP…

A: Amino acids are organic compounds that are joined together to form proteins. Amino acids and…

Q: (c) With the indication of sense strand, template strand, the direction of transcription, provide…

A: Transcription is a heterocatalytic action of DNA by means of which RNA is synthesized from specific…

Q: Convert the DNA template to mRNA.  Then, convert the mRNA  to tRNA. Based from the resulting…

A: Central dogma- RNA is produced from DNA with the help of transcription and then RNA is converted to…

Q: During which process is MRNA synthesized from a DNA template with the aid of RNA polymerase? O…

A: Introduction  Genome is referred to the total amount of DNA a single haploid cell contains. Genome…

Q: Describe the process of protein synthesis and localize where each step takes place.

A: Protein synthesis is the process wherein cells make proteins. It happens in two phases:…

Q: The MRNA copy of the gene goes from the nucleus to the cytoplasm %3D The ribosome reads the…

A: Genes are the basis of genetic inheritance and they store genetic information passed on from the…

Q: (a) Write the complementary base sequence for the matching strand in the DNA section shown below:.…

A: DNA is a double stranded helical structure present inside the nucleus. It acts as a hereditary…

Q: You’re working in Marshall Nirenberg’s lab, trying to decipher the genetic code. You use several…

A: Marshall Nirenberg studied the genetic codes for protein synthesis in his biochemical research. He…

Q: What is the sequence of bases in the template strand of DNA that codes for the mRNA in Problem?

A: The sequence of mRNA given in the problem is 5'AAA GUU GGC UAC CCC GGA AUG GUG GUC 3' and the…

Q: The following segment of DNA codes for a protein. The uppercase letters represent exons. The…

A: Biological macromolecules are those large molecules that are necessary for the survival and growth…

Q: Write a paragraph about transcription, and include the following terms: transcription factors,…

A: Transcription is a process in which RNA molecule is produced from the DNA template strand or non…

Q: Write corresponding mRNA code and the amino acid acid sequence for the DNA segment with the…

A: Transcription is a process of formation of transcript or RNA from DNA by the process of…

Q: Which mRNA would be made if the sequence of the DNA coding strand is GAC? O GAC O GTC O GUC O CUG

A: Amino acids are organic compounds with amino and carboxyl functional groups as well as a side chain…

Q: Construct a polypeptide chain by translating the given red strand of the mRNA segment.…

A: Translation It is defined as the process of protein synthesis in which the sequence of mRNA is…

Q: following is a series of DNA triplets. first, transcribe the correct complementary sequence of mRNA…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain,…

A: The central dogma involves two processes to bring about gene expression, namely transcription, and…

Q: If the DNA has a triplet code of CAG in one strand (the strand used as a template for transcription)…

A: DNA and RNA are are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid…

Q: If an mRNA nucleotide is synthesized from DNA, how do you identify the:   5’end; 3’ UTR;…

A: The promoter sequence serves as a site for binding of RNA (ribonucleic acid) polymerase. It is…

Q: Determine each of the following items using the hnRNA nucleotide sequence (enter the answer using…

A: “Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: Below are the general steps of protein synthesis. What is the correct sequence of protein synthesis?…

A: DNA is the nucleic acids present in the organisms. DNA is the deoxy-ribose nucleic acid in which…

Q: The first nucleotide in mRNA that will be synthesized from DNA below is:  3'-…

A: During the transcription process RNA is produced from the DNA within the nucleus of eukaryotic cells…

Q: Match the steps of transcription and translation to the location they take place within a eukaryotic…

A: Transcription is the process of making an RNA copy of a gene sequence. This copy is called mRNA. The…

Q: Which type of RNA best fits each of the statements below, respectively? MRNA, FRNA, MRNA, TRNA,…

A: RNA or the ribonucleic acid is a type of nucleic acid that is present in the cell usually…

Q: Below are the general steps of protein synthesis. What is the correct sequence of protein synthesis?…

A: The process of synthesis of proteins is called translation. Proteins are synthesised in a cell in…

Q: If the following were part of a DNA chain, what mRNA bases would pair with it to transcribe the DNA…

A: INTRODUCTION The carrier of genetic information within a cell is DNA, which stands for…

Q: Coding strand CGT CTC TTC GGA CAC whar is the mRna strand

A: The process of formation of mRNA sequence  from the template strand of DNA is known as…