Examine the following coding strand DNA nucleotide sequence,representing the complete gene sequence (i.e. control elements + RNA-coding sequence) of a bacterial gene. Answer the questions below by using the list of consensus sequences and the genetic code. 6. 5' CGCTCAGAAAATTATATTAAATTTCCTCTTGACACTCGCTTTCGTGATCGTCTTATAATGTGTGGATG CCGAAAACGACAATTTCTGACTTACCGGGGTTTTAAGGAGGTAATATGCAAATTAGCGATACCGGCC GCAGCCACACTCCTGACTTTCACGCCTAGTCGCCCGTGAAGACTGGCACAACCAGACCATTACCCACC TTAACCGCCTGCCAGCGCATCCCGTTTTCGCCAGCTGGCGCGATGAGCTTGCCGCCCGCGATTCAGCC CGCGTAGTAAGCGGGCTTTTTTTGGGAGTGGCAGTTCTCTTACGCCCGCAGCCCG 3' Clearly indicate the following directly on the DNA sequence above: promoter elements - underline and label as (a). the sites for initiation of transcription - use an arrow V and label as (b). the sites for termination of transcription – use an V arrow and label as (c). a. b. с.

Examine the following coding strand DNA nucleotide sequence,representing the complete gene sequence (i.e. control elements + RNA-coding sequence) of a bacterial gene. Answer the questions below by using the list of consensus sequences and the genetic code. 6. 5' CGCTCAGAAAATTATATTAAATTTCCTCTTGACACTCGCTTTCGTGATCGTCTTATAATGTGTGGATG CCGAAAACGACAATTTCTGACTTACCGGGGTTTTAAGGAGGTAATATGCAAATTAGCGATACCGGCC GCAGCCACACTCCTGACTTTCACGCCTAGTCGCCCGTGAAGACTGGCACAACCAGACCATTACCCACC TTAACCGCCTGCCAGCGCATCCCGTTTTCGCCAGCTGGCGCGATGAGCTTGCCGCCCGCGATTCAGCC CGCGTAGTAAGCGGGCTTTTTTTGGGAGTGGCAGTTCTCTTACGCCCGCAGCCCG 3' Clearly indicate the following directly on the DNA sequence above: promoter elements - underline and label as (a). the sites for initiation of transcription - use an arrow V and label as (b). the sites for termination of transcription – use an V arrow and label as (c). a. b. с.

Name: 6. Examine the following coding strand DNA nucleotide sequence,^repre
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 6. Examine the following coding strand DNA nucleotide sequence,^representing the complete genesequence (i.e. control elements + RNA-coding sequence) of a bacterial gene. Answer the questions belowby using the list of consensus sequences and the gene

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter15: From Dna To Protein

Section: Chapter Questions

Problem 5TYK: Which of the following statements is false? a. GTP is an energy source during various stages of...

See similar textbooks

Similar questions

1. Classify the type of mutation that have taken place: silent, missense and nonsense as a result of a single base substitution from UCG codon which codes for cysteine:a) AGC (ser): ________b) UGU (cys): ________c) GGC (gly): _______d) UGA (stop): _______e) UUC (phen): _______2. A single base addition and a single base deletion approximately 15 bases apart in the mRNA specifying the protein lysozyme from the bacterial virus T4 caused a change in the protein fromits wil-type composition….lys-ser-pro-ser-leu-asn-ala-ala-lys…..to the mutant form lys-val-his-his-leu-met-ala-alalys.a. Decipher the segment of mRNA for both the original protein and the double mutant.b. Which base was added? Which was deleted?3. Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 5’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 3’a. What is the complementary strand?b. Deduce the mRNA in this coding region.c. What is the amino acid sequence based on this…
1. The specific sequence component of the bacterial promoter located 10 base pairs upstream of the bacterial gene start site is called?
1.- Outline the general process of transcription (dna->rna) include a diagram a) include the basic enzymes involved and a description of their actions b) what is the product of transcription c)what will the cell do with the product d)where does the transcription take place in prokaryotic cell
1. Which of the following explains why prokaryotes have a bigger gene-to-genome size ratio compared to eukaryotes? A. Prokaryotic genome contains multiple promoters and repressors that control of a single gene.B. Prokaryotic genome is completely devoid of non-coding sequences.C. Prokaryotic genome contains multiple genes that are under the control of a common promoterand repressor.D. Prokaryotic genome contains one promoter region for each gene. 2. Which of the following can explain why eukaryotes have smaller gene-to-genome size ratio compared to prokaryotes?A. Genome size do not correlate with complexity in eukaryotes.B. The percentage of genes is inversely correlated with genome size in eukaryotes.C. Eukaryotic genome contains a lot of coding sequences.D. Eukaryotic genome contains a lot of non-coding sequences.
1. Why aren't ssb proteins necessary in transcription?
1. Considering the following nucleotide sequence in an mRNA molecule: 5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3' a) Write the sequence of the DNA template (antisense) strand from which the mRNA was synthesized. b) Write the sequence of the DNA coding (sense or informational) strand complementary to the template strand. c) Write the sequence of tRNA anticodon that corresponds to the given mRNA molecule. d) Write the amino acid sequence of the peptide synthesized from the given mRNA nucleotide sequence. e) Draw the structure of the pertide fragment made up of the first five (5) amino acids in the given polypeptide.
4) Shown below is a schematic drawing of a gene, with the transcription unit divided into numbered regions. The arrows indicate transcription initiation sites, "D" indicates a splice donor site, "A" indicates a splice acceptor site, and "An" indicates a polyadenylation signal. Indicate all the possible mRNAs that could be produced from this gene (you don't need to draw new schematics - just list the regions that would be included in each mRNA by number)
1. Which of the following conditions will result to deactivation of a gene? a. histone methylation b. phosphorylation of a transcription factor c. binding of hormones to its nuclear receptor d. deactivation of transcription factor inhibitory protein 2. Direct complementarity of the microRNA to the target mRNA will lead to a. mRNA degradation b. inhibition of transcription c. chromatin remodeling d. inhibition of translation
1. What is the nucleotide sequence of the mRNA transcribed from the template DNA strand: 3’-GCTACAAAAAGTCCATAATCGC-5’? Indicate the 5’ and 3’ ends. Follow the same format as the given sequence. 2. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids in the peptide? Use the 3-letter code of the amino acids. Separate the amino acids with a dash (-). NO NEED to indicate the N- and C-terminal amino acids. Assumption is that the first amino acid is the N-terminal. 3. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids in the peptide? Use the 3-letter code of the amino acids. Separate the amino acids with a dash (-). NO NEED to indicate the N- and C-terminal amino acids. The assumption is that the first amino acid is the N-terminal.
1. This complex assembles and organizes nucleosomes and contributes to gene repression Group of answer choices a. SWR1 Complex b. ISWI Complex c. SWI/SNF Complex d. SWI Complex 2. A DNA lesion occurring when the deoxyribose molecule loses an adenine or a guanine base. Group of answer choices a. Depurination b. Deamination c. Depyrimination d. Denaturation 3. The difference between a nucleoside and nucleotide is: Group of answer choices a. Nucleotides contains deoxyribose sugar and nucleosides contain ribose sugar b. A nucleoside consists of the sugar with a nitrogenous base, whereas a nucleotide has sugar with a nitrogenous base and phosphate groups attached to the sugar. c. A nucleotide consists of the sugar with a nitrogenous base, whereas a nucleoside has sugar with a nitrogenous base and phosphate groups attached to the sugar. d. Nucleotides are involved in eukaryotic DNA replication, while nucleosides are used in bacterial DNA replication
1.A portion of an mRNA attached to a ribosome reads: 5′ GACAUGAACAGC 3′ If a tRNA with a methionine amino acid attached is in the P site of the ribosome, a tRNA with which amino acid attached will enter the A site? Group of answer choices a. Glutamic Acid b. Lysine c. Threonine d. Asparagine 2. Active transcription does not occur in regions of chromatin loops that are located ________. Group of answer choices a. A large distance away from the MARS b. Within the euchromatin c. Near the MARS d. A large distance from the telomere 3. Given the DNA sequence 5′-AUG GCU AGA GUU GAA AAA-3′, which of these sequences represents a silent mutation? Group of answer choices a. 5′-AUG GUU AGA GUU GAA AAA-3′ b. 5′-AUG GCU UGA GUU GAA AAA-3′ c. 5′-AUG GCU AGA GUU GGA AAA-3′ d. 5′-AUG GCU CGA GUU GAA AAA-3′
1. a)how is it possible for such drugs to selectively kill bacterial cells and not our own cells? b)Provide an example of post-translational regulation of protein activity and explain the advantage of regulating each protein/process at the post-translational level instead of the transcriptional level.