Exercise 1: Write a python program that reads from a text file whose name is provided by the user and including lines relating to the dimensions of three kinds of shapes: Circle, Triangle, Trapezoid (see figure below for a sample input file). For each shape compute and display its area: - Triangle area - Circle area = n radius?. - Trapezoid area =; (base 1 + base2)X height. base X height. Your program should consider the following erroneous cases: • The file does not open/exist • The format of the data in the file is incorrect (e.g. shape name = 'Polygon'), the shape's dimensions are incorrect (e.g. negative value or number of values for a trapezoid not equal to 3: baseı, basez and height, or), in which case RuntimeError exception should be raised and the processing should continue. Shape Area Triangle: Circle: -10 50 48 Trapezoid: 10 12 70 Trapezoid: Triangle Circle 1200.00 9. 32 >> invalid dimension Trapezoid Trapezoid 770.00 >> missing data. Sample input file Sample output

Exercise 1: Write a python program that reads from a text file whose name is provided by the user and including lines relating to the dimensions of three kinds of shapes: Circle, Triangle, Trapezoid (see figure below for a sample input file). For each shape compute and display its area: - Triangle area - Circle area = n radius?. - Trapezoid area =; (base 1 + base2)X height. base X height. Your program should consider the following erroneous cases: • The file does not open/exist • The format of the data in the file is incorrect (e.g. shape name = 'Polygon'), the shape's dimensions are incorrect (e.g. negative value or number of values for a trapezoid not equal to 3: baseı, basez and height, or), in which case RuntimeError exception should be raised and the processing should continue. Shape Area Triangle: Circle: -10 50 48 Trapezoid: 10 12 70 Trapezoid: Triangle Circle 1200.00 9. 32 >> invalid dimension Trapezoid Trapezoid 770.00 >> missing data. Sample input file Sample output

Database System Concepts

7th Edition

ISBN:9780078022159

Author:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Publisher:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Chapter1: Introduction

Section: Chapter Questions

Problem 1PE

See similar textbooks

Similar questions

Write a Python program in a .py file that includes the following: Program reads, formats and prints a restaurant menu from menu.txt (see at the bottom).Customer orders menu items by name or an assigned item number until a key word is entered such as "I'm Done" or "Exit".Customer order and net total is printed as output to a new text file. -----------------menu.txt-----------------Ham and Egg Sandwich $15.75Bacon and Cheese Plate $9.50Tuna Salad $12.30Beef Soup $9.00Spicy Beef Barbeque $20.00Pork Barbeque $18.00Oven Chicken Barbeque $15.00Pulled Beef Barbeque Burger $25.00House Salad $5.00Pellegrino $5.40White Wine $7.50Red Wine $11.00
Write a java program that will read a text file that displays a list of the largest US Cities and their 2019 population. The user will be prompted to enter a file name and your program will print a title (“City Population”) and the list of cities in the file. Use either Scanner or JOptionPane to query the user for the filename. (The file provided is named “USCities.txt”.) The output should appear as follows: Enter the filename: USCities.txt City Population New York City 8,336,817 Los Angeles 3,979,576 Chicago 2,693,976 Houston 2,320,268 Phoenix 1,680,992 Philadelphia 1,584,064 San Antonio 1,547,253 San Diego 1,423,851 Dallas 1,353,573 San Jose 1,021,795
Write a complete python program with a main function that reads from a file called numbers.txt and outputs to a file called answers.txt Numbers.txt has one or more lines where each line contains two numbers Your program should read through numbers.txt and with each line. Multiplies the first number by the second and outputs the results to answers.txt If inputs.txt contained 5 4 3 4 6 4 After your program runs answers.txt should contain 20 12 24
Write a Python program that reads from the user the name of two files (an input file and an output file). The program will then read each line of the input file and save it in the output file preceded with the line number and removing any of the following punctuations (. , ! ? ; :) found at the end of the line. For example, if the input file is:Mary had a little lamb;Whose fleece was white as snow; And everywhere that Mary went; The lamb was sure to go!Then the output file the content of the input file and saves it in the produced output file will beLine 1: Mary had a little lambLine 2: Whose fleece was white as snow Line 3: And everywhere that MaryLine 4: The lamb was sure to go
Create a python program that creates a file named HAL-9000.txt and writes the following text to it: HelloDoctorNameContinueYesterdayTomorrow There are SIX lines of text, no more, no less. Remember, it is your responsibility to tell Python when to create a new line.
Write a Python program sentences.py that prompts for multiple sentences. The program should write the sentences without punctuations with the words in reversed order and in uppercase in a new file named sentences.txt. All words must be separated by single space. Example 1 prompt (input:) Enter a sentence: What's your address?Enter a sentence: 964 S. Monroe Ave. Naugatuck, CT 06770Enter a sentence: quit (output:) (In a new file) ADDRESS YOUR WHATS 06770 CT NAUGATUCK AVE MONROE S 964
Write a program that reads a stream of integers from a file and prints to the screen the range of integers in the file (i.e. [lowest, highest]). You should first prompt the user to provide the file name. You should then read all the integers from the file, keeping track of the lowest and highest values seen in the entire file, and only print out the range of values after the entire file has been read. In Java.
Create an input text file that has the name input.txt with the following content. In Java please. 10 45 23 14 76 55 14 34 11 4 12
You have to collect information about the states in your country and then store each states’ name, size, population, Governor, and secret name in a file. Unlike other input, Secret name will be generated from states’ name in a separate method which change vowels alphabet of input string states’ name into the number as given in the following table. ( Table Attached----Table Attached----Table Attached) Write a python program to accept the data for a number of states from the keyboard and store the data in a file in the order in which they’re entered.
Write a program that reads a student's name followed by five test scores. The program should output the student's name, the five test scores, and the average test score. Output the average test score with two decimal places. The data to be read is stored in a file called test.txt. The output should be stored in a file called testavg.txt. test.txt: A file containing the student names and the five test scores for every student. Andrew Miller 87.50 89 65.75 37 98.50 Green Sheila 91.05 75.88 50.0 65.5 74.30 Sethi Amit 49.82 75 30 74 86.30 testavg.txt: A file containing the student name, the five test scores, and the average of the five test scores for each student.
Please do this in PYTHON PROGRAMMING Write an address book program that stores your contacts' names and their email addresses. The names and email addresses are originally stored in a file called phonebook.in, in the format:Harry P..d@hogwarts.eduHermione G..h@hogwarts.eduRon W..b@hogwarts.eduDraco M..s@hogwarts.eduSeverus S..e@hogwarts.eduAlbus D..x@hogwarts.eduYour program should read from the file, storing the names and corresponding email addresses in a dictionary as key-value pairs. Then, the program should display a menu that lets the user enter the numbers 1 through 5, each corresponding to a different menu item:1) look up an email address2) add a new name and email address3) change an email address4) delete a name and email address5) save address book and exitWhen the user enters 1, the program should prompt them for a name, and then print the corresponding email address. If there is no dictionary entry under that name, the program should print, "Sorry, no contact exists…
Run a python program that will: a. Read a text file (input.txt) that contains two lines wherein the first line is a normal DNA sequence, while the second line is a mutated DNA sequence. b. The program must also transcribe and translate the sequences by providing outputs for their respective mRNA and protein products. *** input.txt *** ATGGTCAGAACGCGCTGAAATGGTTAGAACGCGCTGAC *** your.py *** Normal RNA Sequence: UACCAGUCUUGCGCGACUUMutated RNA Sequence: UACCAAUCUUGCGCGACUG Normal Protein Sequence: Try Gln Ser Cys Ala ThrMutated Protein Sequence: Try Gln Ser Cys Ala Thr