Explain the effect that maternal body weight has on the health of the mother and infant by describing the increased health risks seen in underweight mothers and obese mothers.

Q: r a 12-carbon saturated fatty acid, calculate the following: er of acetyl COA er of NADH produced…

A: In one pass through the fatty acid oxidation sequence one molecule of acetyl coenzyme A, 2 pairs of…

Q: What is meant by energy flow in an ecosystem? What are the laws of thermodynamics?

A: Introduction  An ecosystem is a geographical area in which plants, animals, and other species, as…

Q: Which of these variables is NOT ethically practiced when producing transgenic animals…

A: Genetically altered animals or transgenic animals are animals with a modified genome due to the…

Q: Q4.7. In DNA replication, what is the difference between the leading and lagging strands? In the…

A: Replication is the process by which double stranded DNA molecule is copied to produce two identical…

Q: Mang Isko has one hectare corn production with high-value vegetable near in it.  He wanted to apply…

A: The herbicides are mainly a medium used to kill unwanted plants or to arrest the growth of the…

Q: Q2- The charge in nerve axon depending on-------inside axon, ----outside axon Na, K OK,Na k,CL

A: In neuron ,  Positively charged Na+ ion is pumped out and  positively chared K+ ion is pumped…

Q: Sketch the four gametes produced by a CROSSOVER between C and D and label whether or not each gamete…

A: Inversion - An inversion is a chromosome rearrangement in which a segment of a chromosome is…

Q: Summarize the steps in generating an action potential as a flowchart. You can make your flowchart on…

A: Action potential occurs when the already negative potential inside the membrane becomes positive.…

Q: ATCGGCTAGCTACGGCTATTTACGGCATAT The above string of nucleotides represent a DNA leading strand of…

A: DNA is a double helical structure composed of two DNA strands.

Q: Create a maximum 2-page discussion that details the history of vaccines, their advantages and…

A: An individual may be exposed to an antigen to induce immune response a type of immunity known as…

Q: Evaluation of PCR product electrophoresed on 0.8% agarose gel shows non-specific bands. The…

A: Introduction DNA fingerprinting is a technique that is commonly used to identify people based on…

Q: 0 그 Ten O! ㅇㅇ

A: Photosynthesis Phosysnthesiis is a process by which plants synthesise their food. It occurs in the…

Q: 7. is the high energy carrier that is regenerated during fermentation that allows cell to continue…

A: The process of breakdown of glucose to various intermediates and finally convert to pyruvate is…

Q: 11. The amino acids of proteins can enter the process of cellular respiration, but first the must…

A: Cellular respiration is a metabolic process that breaks down glucose and produces ATP. Stages of…

Q: Trace the incorrect statement Trypanosoma is the organism that is the causative factor of sleeping…

A: Trypanosoma is a genus of unicellular parasitic flagellate protozoa belonging to the class…

Q: We use salting and freezing to preserve our food against bacteria. Explain why is food preserved…

A: Salting: Common salt (NaCl) used to preserve food by making it unavailable for microorganisms.…

Q: 20. Activity involving two or more microorganisms seeking the same niche or nutrients. M 26. The…

A: Microbial interaction defines the interaction of a microbe with the other one or with any other…

Q: ribonucleotide double helix tRNA phosphodiester bond hydrogen bond polymer mRNA…

A: The DNA and RNA both are the examples of nucleic acids. The DNA is double stranded helical molecule…

Q: ITEM MSM MICROBIAL PROFILE MICROORGANISM/CAUSATIVE I AGENT A GRAM REACTION B OXYGEN REQUIREMENT с…

A: A "microbe" is a living entity that is so tiny that it cannot be seen with the naked eye.…

Q: The classification of viruses are similar to the classification of organisms in the three domains of…

A: Viruses are microscopic pathogenic organisms which can only multiply inside a host cell and are…

Q: 44+ OC 4H+ Ţ 24+ 3 Ht

A: The electron transport chain (ETC) that happens in the mitochondrial inner membrane is called…

Q: Which type of nephron (juxtamedullary or cortical) does this setup appear to approximate? Hint: pay…

A: Juxtamedullary nephron concentrate or dilute urine. Cortical nephron  perform excretory and…

Q: Match the fat soluble vitamin with the best food source fortified dairy, fatty fish, SUN orange,…

A: Introduction Vitamins are needed for the normal cell function, growth, and development, An…

Q: Which of the following is the most likely explanation for an individual who lacks CCR5 as a result…

A: Introduction  Human immunodeficiency viruses (HIV) are two Lentivirus (a retrovirus subgroup)…

Q: Answer the questions in the frame below. 1. What organ(structure) is shown in the figure? 2. What is…

A: Introduction: Blood arteries are made up of concentric layers or "tunics" of distinct tissue types,…

Q: Read the clues and classify as Virus, Archaebacteria, Eubacteria, VIRUSES ARCHEABACTERIA EUBACTERIA…

A: Viruses are significantly smaller than bacteria, and they are made up of a single or double-stranded…

Q: If jaguar populations become isolated, would this be enough to classify them as subspecies?

A: Jaguar considered as keystone species that means, they are the apex predators which helps in keeping…

Q: In what way did the followers of Galen disregard his advice? How does Galen’s advice apply to you…

A: Introduction  Dissection is the dissection of a deceased animal or plant's body in order to analyse…

Q: Write short notes on dry heat as a physical antimicrobial control method.

A: Drying can be used to control the growth of microorganisms because when water is removed from cells,…

Q: Q4.10. A cell has been exposed to a poison that stops ligase from working. If all other enzymes are…

A: The mechanism wherein the genome's Dna is replicated in cells is known as DNA replication. Prior to…

Q: 1. Identify and label the parts of the following specimens in Phylum Mollusca: Class: Genus: Common…

A:

Q: How do HIV criminalization laws conflict with the medical evidence on how HIV is spread. In the…

A: The human immunodeficiency virus (HIV) is an infection that targets the immune system, primarily CD4…

Q: Which of the following is true of overexploitation? Select ALL that apply.   a Only animals are…

A: Overexploitation is the exploitation of a resource to the point of depletion. It occurs when the…

Q: The non-wild-type alleles are k (clipped wings), l (long tail), and m (magical powers). The parental…

A: Here the test cross that produced 1572 offspring was conducted between k/k+  l/l+  m/m+…

Q: Which of the following nutrients are absorbed in the stomach? a Carbohydrates, lipids, and…

A: The gastrointestinal tract, as well as the digestive organs that support it, make up the human…

Q: 2. What is the name of the tissue (the structure) labeled A? 3. What is the name of the tissue (the…

A: Tooth Development or Odontogenesis is the complex process by which teeth form from embryonic cells,…

Q: Cohort: Order: Genus: Common Name:

A: Phylum Platyhelminthes  Platyhelminthes are the soft body invertebrates flattened animals.

Q: To determine: Whether the nonspecific or the specific arms of the immune response evolved first in…

A: Introduction: Innate defense and adaptive defense are two body mechanisms that protect against…

Q: If B cells making high-affinity IgG4 are unable to switch to IgE at a late stage in the germinal…

A: Helminths are parasites that cause several infections.

Q: Describe the clonal deletion.

A: The immune system is a sophisticated biological system that can recognize and accept self-cells…

Q: Chemical composition of carbohydrates

A: Introduction: Carbohydrates are sugar molecules that are part of a wider group of macromolecules…

Q: the liquid viscosity is density intendent. True O False during the diastolic of the cardiac cycle…

A: Introduction  When the membrane potential of a specific cell region rapidly rises and falls, it is…

Q: Match the water soluble vitamin with its deficiency megaloblastic anemia, cognitive decline, age…

A: Vitamins are the key component of cellular pathways for example- hydroxylation of collagen protein…

Q: CD1-restricted α:β T cells respond to lipid antigens of mycobacterial pathogens using all except…

A: Introduction  The cluster of differentiation (also known as cluster of designation or classification…

Q: Role of Molecular Biology in Evolutionary Classification

A: Introduction :- The study of the molecular basis of biological activity in and between cells,…

Q: Pollen grains are derived from a microsporocyte, developed inside the microsporangia of an anthe and…

A: Flowering plants are known as angiosperms. The reproductive organ of angiosperms is the flower.…

Q: Please give me 1.the definition of vaccine and 2.advantages and disadvantages of vaccines

A: Introduction: After inoculating a 13-year-old child with vaccinia virus (cowpox) and demonstrating…

Q: Choose the incorrect option regarding protein motifs They lose their structure after breaking away…

A: Introduction Proteins are macromolecules made up of one or more long chains of amino acid residues.…

Q: To define the qualities of an effective vaccine.

A: Introduction Vaccines are the biological products which protect our body from different diseases.…

Q: . Briefly describe the following action areas of the Ottawa Charter and explain how they have been…

A: First what is Ottawa charter  The first International Conference on Health Promotion held in Canada…

Nutrition and diet

We are involved in several daily activities. These actions need a significant quantity of energy. The food we eat provides this energy. Food is necessary for development, repair, and other living activities since it supplies energy. All of these are part of the living practice known as nutrition. Nutrition is the study of nutrients in food, how the body uses them, and the relationship between diet, health, and disease. Nutritionists employ concepts from molecular biology, biochemistry, and genetics to understand how nutrients affect the human body. Nutrition also looks at how people can use their diet to reduce their risk of disease, as well as what happens when they ingest too much or too little of a nutrient and how allergies emerge.