Find 3 reactions that facilitate the synthesis of oxaloacetate

Q: ОН ОН ОН tautomerization

A: Tautomerization is the process by which structural isomers interconvert between each other. The…

Q: Could you please explain in detail why they end up in aspartate? Illustrations with 14C labelled…

A: All the metabolic reactions occurring inside the living system provides energy and replenishes the…

Q: Explain biochemical pathways mechanistically. Describe the β-oxidation pathway. Describe the…

A: Lipids are stored in the form of triacylglycerols in the body. When there are no carbohydrates in…

Q: Name four amino acids that can be synthesized using pyruvate as a starting material. What one(s) of…

A: Amino acids are biomolecules that have an amino group and a carboxyl group linked to the same carbon…

Q: In hepatocytes, the enzyme glucokinase catalyzes the ATP-coupled phosphorylation of glucose.…

A: In the reaction mechanism catalysed by glucokinase, glucokinase binds and brings ATP and glucose…

Q: 4. Amphiphilic Lipids. Detergents are small amphiphilic molecules that tend to form micelles in…

A: Ionic detergents contain anionic or cationic head group long with their hydrophobic tails being…

Q: Why should it make sense that a phospholipid molecule is larger than a carbon?

A: An atom is composed of protons, neutrons, and electrons. Same type of atoms combines together to…

Q: 3. After 24 hours of fermentation, no more CO₂ was produced in the presence of sucrose. Assuming…

A: Yeast performs alcoholic fermentation. Alcoholic fermentation is the process by which certain sugars…

Q: Describe how the results of carbon-14 labeling experiments demonstrated that the citrate cycle is a…

A: The citric acid cycle involves the oxidation of acetyl-CoA into carbon dioxide and water. It is the…

Q: Which of the following interactions would be seen between the R-groups of His and Gln at pH 8?…

A: Amino acids are biomolecules that have an amino group and a carboxyl group linked to the same carbon…

Q: The pancreas is an organ of mixed secretion. Endocrinely, beta-cells produce the hormone insulin,…

A: Pancreas has 3 types of cells: α cells secrete glucagon β cells secrete insulin δ cells secrete…

Q: can you explain this again in a different way

A: ATP is produced by either substrate-level phosphorylation or oxidative phosphorylation Hydrolysis of…

Q: what conditions bring about acidosis and alkalosis?   what are the principle metabolic function of…

A: Acidosis is a condition in which there is excess H+ ions in the arterial plasma, while alkalosis is…

Q: Consider the structure of TAMIS below and answer the questions that follow. ОН НО Н H ОН Н H ан .H.…

A: The given structure is a carbohydrate molecule having monosaccharide units joined via glycosidic…

Q: Elongation of fatty acids chains beyond 16 carbons takes place: on the membrane of the endoplasmic…

A: Acetyl CoA from glucose oxidation or other anaplerotic reactions is produced in mitochondria and…

Q: 1. Explain why lipids are insoluble in polar solvents. 2. How do oils and fats differ?

A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…

Q: A new protein is discovered that contains a pleckstrin homology domain. Which of the following…

A: Pleckstrin homology domain is a domain in protein and is made up of nearly 120 amino acids. It is…

Q: Draw the electron pushing mechanism

A: Electron pushing mechanism shows the jumping of electrons in the substrate and reaction…

Q: 6. Biological value of glycogen breakdown in muscles and liver.

A: Carbohydrates are biomolecules that are utilized as the primary source of energy. And glucose is the…

Q: Use a schematic diagram to briefly summarize the steps taken during the separation, isolation, and…

A: Milk is the secretion of fluid from the mammary gland, the full cream milk is composed of ~54.5%…

Q: What are the greatest structural features that differentiate sphingolipids from phosphoglycerides?

A: Introducion Fatty acids are the important component of lipids. Lipid is one of the important…

Q: When muscle is at rest, creatine phosphate is produced from ATP in order to store energy. What is…

A: Most of the time, certain cellular reactions are highly endergonic reaction, that is they are…

Q: What are the qualitative tests to characterize isolated RNA?

A: RNA or ribonucleic acid, most often single stranded nucleic acid found is all living organisms is…

Q: DETAILS 09 Select all of the following half reactions that require energy (work) to proceed as…

A: The reactions that require energy to proceed are called endergonic reactions. The half reactions are…

Q: At pH 10, what is the net charge of the peptide Asn-His-Glu-Cys-Ser-Lys?

A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…

Q: Next exam will be on carbohydrates, protein equencing and enzymes iochemistry roblem Assignment…

A: Emil Fischer invented the Fischer projection, a method of representing the three-dimensional…

Q: Choose the statements that describe why the isomerization reaction is critical for the subsequent…

A: Glycolysis is the collection of 10 enzymatically catalysed reactions that sequentially oxidises a 1…

Q: Suppose a student rinses their buret with water instead of sodium hydroxide, leaving water in the…

A: Introduction The titration is a chemical process by which the quantity of one substance of a sample…

Q: 5. Arrange the following fatty acids in order from lowest melting point to highest: myristic acid,…

A: Since you have posted multiple questions, we will provide the solution only to the first question as…

Q: Which of the following amino acids has a negatively charged atom in its side chain at pH 7.2? a. V…

A: Amino acids are biomolecules that have an amino group, a carboxyl group and a side group linked to…

Q: name this reaction

A: The catabolic process of glycolysis is performed by almost every living cell. Glycolysis is the…

Q: A total of 7.21 g of dry mixture with a protein content of 89.2% (w/w) determined by Kjeldahl…

A: % w/w tells us the grams of analyte in 100g of mixture. Hence, a protein content of 89.2% (w/w)…

Q: Given the structure of the lipid. Hox N-H • To which group does this lipid belong? Triacylglycerol}…

A: Lipids are biomolecules that are insoluble in water. They are made up of fatty acids and glycerol.…

Q: 3. With a deficiency of thiamine - vitamin B1, beriberi disease (polyneuritis) occurs and…

A: Carbohydrates consumed in diet enter the glycolytic pathway as glucose. Pyruvate is the end product…

Q: • What is the common name of this fatty acid? cerotic acid, lauric acid, lignoceric acid, linoleic…

A: Fatty acids (FA) are aliphatic chain with one terminal carboxylic acid. Based on the presence or…

Q: From the three figures below, indicate which represents best the catalytic pocket of trypsin, a…

A: Serine proteases are the group of enzymes that cleaves the peptide bond in proteins, where Ser…

Q: b-oxidation occurs ONLY under aerobic conditions. Why? Glycolysis occurs under anaerobic conditions,…

A: Beta-oxidation of fatty acids is the process by which long chain fatty acid molecules are broken…

Q: Catabolism - draw the complete citric acid cylcle for myristate

A: Myristate is a saturated fatty acid with 14 carbon atoms. Fatty acids are metabolized through the…

Q: Which of the following monosaccharide phosphates is NOT produced in the pentose phosphate pathway?…

A: In animal tissues, glucose has two possible fates: be oxidised into carbon dioxide and water by…

Q: Label the parts of the below lipid molecule. Is this a saturated or unsaturated lipid? H H I-U-I H…

A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…

Q: Experiment: DNA Extraction from Banana The procedures are attached below. Question: 1. Will the…

A: DNA is the genetic material that is presented inside the nucleus of every cell. Banana is the best…

Q: true/false: The cofactor ATP is essential in all transamination reactions.

A: Transamination is a reaction which results in transfer of an amino group to a keto-acid in order to…

Q: Explain the importance of solubility in drug product formulation.  2.

A: Solubility, the phenomenon of dissolving a solute in a solvent to produce a homogeneous system, is…

Q: answer question 2 please  asap

A: Polymerase chain reaction (PCR) can amplify a single target DNA fragment from a complex mixture of…

Q: 14. Consider the molecules below and the answer questions that follow. CH-0-8-R₁ HC-0-C-R₂ 0-4-0-0₂…

A: Since you have posted multiple questions with multiple sub parts, we will provide the solution only…

Q: 7) In DNA/RNA chains, what is the direction of synthesis?

A: Since you have posted multiple questions, we will provide the solution only to the first question as…

Q: 5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above…

A: The DNA contain genes (functional unit) that encode protein molecules. Proteins are the "workhorses"…

Q: One of the molecules listed below is effective in reducing O2 affinity of human Hb in the absence of…

A: Hemoglobin is a globular protein, ie it is roughly spherical. It is a tetramer of two types of…

Q: Which of the following first messengers is hydrophobic and binds to a nuclear receptor protein…

A: The first messengers are extracellular biomolecules that bind to the cellular receptor and elicit a…

Q: Make 2 mL of 50 fold dilution of DNA solution and sodium phosphate buffer.  DNA: 400 uL Sodium…

A: Dilution is the process of lowering the concentration of a solution by adding more of solvent to it.…

Nucleotides

It is an organic molecule made up of three basic components- a nitrogenous base, phosphate,and pentose sugar. The nucleotides are important for metabolic reactions andthe formation of DNA (deoxyribonucleic acid) and RNA (ribonucleic acid). 

Nucleic Acids

Nucleic acids are essential biomolecules present in prokaryotic and eukaryotic cells and viruses. They carry the genetic information for the synthesis of proteins and cellular replication. The nucleic acids are of two types: deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). The structure of all proteins and ultimately every biomolecule and cellular component is a product of information encoded in the sequence of nucleic acids. Parts of a DNA molecule containing the information needed to synthesize a protein or an RNA are genes. Nucleic acids can store and transmit genetic information from one generation to the next, fundamental to any life form.