For each of the following, identify whether that sequence or feature of a typical protein-coding gene would be recognizable in the specified molecule in a typical prokaryotic cell. 5' UTR in DNA? 5' UTR in mRNA? Shine-Dalgarno in DNA? Shine-Dalgarno in polypeptide? Promoter in RNA? Promoter in polypeptide sequence? Stop codon in mRNA? Stop codon in the polypeptide sequence? [Choose ] [Choose ] [Choose ] [Choose ] [Choose ] [Choose ] [Choose ] [Choose ] < < < < > > <

For each of the following, identify whether that sequence or feature of a typical protein-coding gene would be recognizable in the specified molecule in a typical prokaryotic cell. 5' UTR in DNA? 5' UTR in mRNA? Shine-Dalgarno in DNA? Shine-Dalgarno in polypeptide? Promoter in RNA? Promoter in polypeptide sequence? Stop codon in mRNA? Stop codon in the polypeptide sequence? [Choose ] [Choose ] [Choose ] [Choose ] [Choose ] [Choose ] [Choose ] [Choose ] < < < < > > <

Name: For each of the following, identify whether that sequence or feature
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: For each of the following, identify whether that sequence or feature of a typical protein-coding genewould be recognizable in the specified molecule in a typical prokaryotic cell.5' UTR in DNA?5' UTR in mRNA?Shine-Dalgarno in DNA?Shine-Dalgarno in p

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 18QP: The following is a portion of a protein: met-trp-tyr-arg-gly-pro-thr-Various mutant forms of this...

See similar textbooks

Similar questions

A eukaryotic cell carrying out transcription and RNA processing is incubated with 32P-labeled ATP. Where will the radioactive isotope appear in mature mRNA if the ATP is labeled at the (a) α position, (b) β position, and (c) γ position?
Suppose that the diagram below represents the genomic organization of an enzyme involved in eye pigment production in mice. Within the gene are four exons. Biochemical analysis has revealed that the active site of the enzyme is located in the C terminus of the protein. -The nucleotide length of each exon and intron is shown. -The dinucleotide sequence GT represents the 5’ splice site and the dinucleotide sequence AG represents the 3’ splice site. Both the 5’ and the 3’ splice sites must be present for splicing to occur. Assume that the first and second stop codons are located immediately after the first and second 5’ splice sites, respectively; the third and fourth stop codons are located near the 3’ end of exons 3 and 4, respectively; all these stop codons are in the correct reading frame. a) draw what the processed mRNA will look like. Include the start codon on the mRNA and label the approximate locations of the 5’ UTR and 3’ UTR on the transcript. (You do not need to add the 5’ CAP…
The following is the only intron sequence of a gene that will be excised during the maturation of the mRNA. But it is not spliced in some tissues, where alternative splicing pattern is seen. Will the amino acid of its protein product following this sequence change? Explain with an example. ATGATAGCCAGACTCGCA
The base sequence of the gene coding for a short polypeptide is TAC CTA CGC TAG GCG ATT GAC T. What would be the base sequence of the mRNA transcribed from this gene? The base sequence of the gene coding for a short polypeptide is TAC CTA CGC TAG GCG ATT GAC T. From your answer to the last question, answer this Using the genetic code, give the amino acid sequence of the polypeptide translated from this mRNA. Use the three-letter abbrebviation of the amino acid and start with the start codon and stop in the stop codon.
The hypothetical mRNA sequence below contains the coding region for a short peptide. What consequence for this peptide does the substitution of the uracil at position 28 of the mRNA with guanine have? GGUUGAAUGGAACAACGCGUGCACCCUUAGAGGUAACCCUCC | G Group of answer choices No consequence, it is a silent mutation. It shortens the peptide by two amino acids. It destroys the start codon of the peptide coding region. It extends the peptide by two amino acid. It replaces one of the original amino acids of the protein with a different one.
The following represent deoxyribonucleotide sequences in the template strand of DNA: Sequence 1: 5′-CTTTTTTGCCAT-3′ Sequence 2: 5′-ACATCAATAACT-3′ Sequence 3: 5′-TACAAGGGTTCT-3′ (a) For each strand, determine the mRNA sequence that would be derived from transcription. (b) Using Figure 12–7, determine the amino acid sequence that is encoded by these mRNAs. (c) For Sequence 1, what is the sequence of the partner DNA strand?
Consider this nucleotide sequence of DNA strand in the image provided. If this strand is the sense strand, Give the correct nucleotide sequence of the RNA produced after transcription. If the RNA formed in #1 is already a functional mRNA and will be used to synthesize proteins, how many codons are present here that will actually code for amino acids? What is the sequence of the stop codon in this mRNA? What is the sequence of the 3rd codon in this mRNA? What is the sequence of the last codon in this mRNA that actually code for an amino acid?
Here is a eukaryotic gene. The numbers given are base pairs of exon and intron. How long in bases will the pre mRNA transcript be? Explain briefly. What is the maximum number of amino acids that could make up the protein product from the final mRNA? Explain briefly.
Consider the Rho-dependent terminator sequence 5’CCCAGCCCGCCUAAUGAGCGGCCUUUUUUUU-3’. What affect would a point mutation at any one of the bolded and underlined nucleotides disrupt termination of transcription? Group of answer choices Mutation in one of these nucleotides would disrupt base pairing, preventing the formation of the hairpin and disrupting termination. Mutation in one of these nucleotides would have no affect on base pairing, so the termination hairpin is formed and termination proceeds. Mutation in one of these nucleotides would not disrupt base pairing, but would prevent the formation of the hairpin and disrupt termination. Mutation in one of these nucleotides would disrupt base pairing, but not affect the formation of the hairpin and termination proceeds.
In a study of several families for differences in the sequence of a particular gene suspected to cause a disease. Resulting in the discovery of different mutations in the genes of some families. For each of the mutations, specify if it could change the size or the quantity of mRNA and/or protein product? What kind of change would you predict? Explain each answer briefly. d. AAG378UAG e. promoter mutation. f. one base-pair insertion into codon #765 g. deletion of whole codon #765 h. G-to-A substitution in the 5' UTR i. insertion of 100 base pairs into the fourth intron (this insertion does not alter splicing).
The following is as segment of mRNA: 5'-UCGGAAUGUGGUGGCAUACAGGCUUACAGAACUAAGUCUGAGAAU-3' A. How many amino acids long will be the protein translated from the only reading frame available in this segment? B. If a mutation changes the third letter of the stop codon in the only reading frame available in this segment, how many amino acids long will be the protein translated?
Shown below is a portion of a wild-type DNA sequence that encodes the last amino acids of a protein that is 270 amino acids long. The first three bolded base pairs indicate the frame and include the coding region. 5^ ...GCTAAGTATTGCTCAAGATTAGGATGATAAATAACTGG 3^ 3^.. CGATTCATAACGAGTTCTAATCCTACTATTTATTGACC 5^ Which strand is the template strand for transcription of this gene? Briefly explain how you know. An insertion of one base pair causes the protein to decrease in length by seven amino acids. With respect to the sequence given above, where does this insertion occur? A change of one base pair leads to the protein increasing in the length by one amino acid. With respect to the sequence given above, which base pair would you change, and what would you change this base pair for the protein to increase in the length by one amino acid?