For initiation of replication to occur, DNA topoisomerase and DNA helicase is needed to unwind DNA and break open the DNA double helix respectively. What other enzyme is needed for DNA initiation by DNA polymerase to occur (the answer is not DNA polymerase!)?

For initiation of replication to occur, DNA topoisomerase and DNA helicase is needed to unwind DNA and break open the DNA double helix respectively. What other enzyme is needed for DNA initiation by DNA polymerase to occur (the answer is not DNA polymerase!)?

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter11: Genome Alterations: Mutation And Epigenetics

Section: Chapter Questions

Problem 18QP: Replication involves a period of time during which DNA is particularly susceptible to the...

See similar textbooks

Related questions

Q: Can you draw a prokaryotic heterotrophic electron transport chain?

A: The process of cellular respiration involves the oxidation of biological fuels in the presence of an…

Q: ped is defined as an eating disorder in which people cannot maintain 85 percent of their ideal body…

A: Not maintaining even 85% of the total body weight in a person can make him completely underweight.…

Q: Relative amounts Innate immune cells Pathogen Adaptive immune cells Primary immune response…

A: The immune system is responsible for protecting the body against harmful pathogens, such as viruses,…

Q: Review the biome shown in the illustration below. What biotic factor contributes to the…

A: The question is centered around a specific biome characterized by various features, such as diverse…

Q: The arrow in the diagram below indicates the direction of transcription. TTT AUGCCGCAAUC B TTT…

A: DNA replication is the process by which a cell copies its DNA prior to cell division. It is a…

Q: 1-Recent testing has determined that Kate Middleton (the wife of Prince William) is a carrier for…

A: Note: “Since you have posted multiple questions, we will provide the solution only to the first…

Q: search for information about rabbits about their use for research, abound in information. put a…

A: Leporidae is a family of small mammals that includes rabbits. Their powerful hind legs, which they…

Q: How could ChatGPT and MidJourney help with biological science and biotechnology?

A: Biological science, also known as biology, is the study of living organisms, including their…

Q: Catalase is an enzyme responsible to toxify; H₂O2 toxify; H₂O detoxify; H₂O2 detoxify; H₂O from…

A: Enzymes are biocatalyst that perform specific biochemical reaction inside of the living organisms.…

Q: please look for information about the rabbit about its scientific name, common names, place of…

A: Scientific classification is a hierarchical system used to categorize and organize living organisms…

Q: What is the microbiology laboratory test that Identifies Pseudomonas soli and what are the results…

A: A microbiology laboratory is a specialized laboratory that focuses on the study of microorganisms,…

Q: Messenger RNA in eukaryotic cells is synthesized by which of the following enzymes (strongly…

A: Messenger RNA (mRNA) is a type of RNA molecule that carries genetic information from the DNA in the…

Q: In a breed of mice fur coat color is determined by two genes. For coat color BB results in black, BT…

A: The question explores the inheritance patterns of fur coat color in a breed of mice determined by…

Q: Can you please help me fill in the chart on the time a onion root cell will spend in each phase?

A: The duration of each phase of the cell cycle can vary depending on the type of cell and its specific…

Q: Describe the processing of Pre-mRNA

A: Pre-mRNA or precursor mRNA is the initial transcript produced during transcription of a gene in…

Q: In angiosperms, after fertilization, the triploid cell gives rise to ____. a fertilized ovule a…

A: Flowering plants known as angiosperms produce the flowers and fruits that contain their seeds. They…

Q: What does an onion cell look like at anaphase (400x)?

A: Cell division is a tightly regulated multi-step process by which the cell splits into two daughter…

Q: Which of the following wound infections are zoonoses? Check All That Apply Pasteurella multocida…

A: Zoonotic pathogens, which may infect people through food, water or unconventional agents, can be…

Q: Link: https://doi.org/10.1186/s12868-022-00692-1 A. In the effect of mitoxantrone on…

A: Axons are long, slender extensions of nerve cells, also called neurons, that transmit electrical…

Q: Citrate Utilization…

A: The capacity of an organism to utilise citrate as a source of energy is examined using citrate agar.…

Q: Give an example of 1 antibiotic that targets each of the following in a bacterial cell (1 antibiotic…

A: Antibiotics are a class of drugs used to treat bacterial infections by either killing the bacteria…

Q: mRNAs undergoing degradation are often localised to: Processing bodies Lysosomes Mitochondria The…

A: mRNA degradation is a cellular process that involves the breakdown and removal of messenger RNA…

Q: What are the 8 possible gamestes that can be formed from the following genotype. AaBBEeFf. List…

A: Gametes are cells that contain only one set of dissimilar chromosomes. As they contain half of the…

Q: Which statement about transposons is INCORRECT? a.A transposon is a small fragment of DNA that…

A: Genes make proteins, which are important for our body to work properly. That's why it's really…

Q: Table 1- Comparison of the effect of catechol concentration on the amount of product formed.…

A: Enzymatic reactions refer to chemical reactions that are facilitated or catalyzed by enzymes.…

Q: 12. RNA transcripts can be modified in several ways: processing, splicing, 5’ capping, 3’ poly A…

A: Ribonucleic acid is referred to as RNA. RNA is a single-stranded structure. Adenine (A), guanine…

Q: is a multiple choice question pick the right answer from one of the five choices

A: During the translation process a codon that consists of three nucleotide codes for a single amino…

Q: Give typing answer with explanation and conclusion which two hormones produced by the pancreas help…

A: A hormone is a chemical messenger produced by the endocrine glands in the body. Hormones are…

Q: Computerized tomography: B. Technical aspects (how it works or works)

A: Computerized Tomography (CT) is a medical imaging technique that uses X-rays to create detailed…

Q: What is the microbiology laboratory test that Identifies Pseudomonas maumuensis and what are the…

A: A microbiology laboratory is the study of microorganisms, such as bacteria, viruses, fungi, and…

Q: AUGCCGCAAUCUGUUCACGCACUCAUGUG TII CAC & CACICATETE Direction of synthesis- BTTT ATGCCGCA сш TTT…

A: The term "mRNA" is defined as a single-stranded molecule that carries genetic code from DNA used to…

Q: True or false there are many nuclei at the end plate? True or false motor neurons stimulate muscle.

A: Motor neurons are a type of nerve cell that is responsible for controlling voluntary and involuntary…

Q: Answer by listing only the name of the disease. Some questions will require the name of the…

A: Here we have given two cases like a 28-year-old woman who has headaches and often has watery poop…

Q: The diagram depicts two stages of meiosis. Focusing on the cell to the right of the arrow: (A) What…

A: Cell division known as meiosis takes place in sexually reproducing organisms. Four daughter cells…

Q: 1- Individual 13 decides he wants children and marries a woman is not affect or a carrier for…

A: Genetics helps us understand the fundamental causes of illnesses and disorders. By considering…

Q: Proteins that share significant amino acid similarity are called ______. ________ are related…

A: Large, intricate molecules called proteins carry out a variety of essential bodily tasks. They are…

Q: GENETICS: X LINKED GENES In fruit flies, eye color is a sex linked trait. Red is dominant to white.…

A: Only first question has been answered as per guidelines. For rest of question pls repost and…

Q: Urea Hydrolysis…

A: PH stands for "potential of Hydrogen" and refers to the acidity or alkalinity of a substance. A pH…

Q: For Meal Worm give the reader background on the relevant science like the species, life cycle,…

A: Adult Meal worms reside in dark, cool, and moist locations. These locations are usually rich in…

Q: Q1) What is the name of the enzyme found in potato extract? Answer: Catechol Q2) What is the…

A: In the experiment enzyme acts on the substrate to lower its activation energy so that substrate in…

Q: What information does the pain receptor relay to the brain about stimuli BELOW threshold 1)The…

A: Receptors are essential as they help us feel and react to things both inside and outside our bodies.…

Q: B 444b 44444 Rh on #4 - Suzie A Rh 6. What is Trevor's blood type genotype? B- 7. What blood types…

A: The ABO blood group is based on the presence of specific antigen on the RBC. During blood donation,…

Q: In the Figure below you can see an Aardvark (1), an Ant eater (2) and a Pangolin (3). Aside from…

A: The Aardvark, Anteater, and Pangolin are all unique mammals with distinctive characteristics.…

Q: Answer by listing only the name of the disease. Some questions will require the name of the…

A: Answers of the above questions are provided below in step 2

Q: physical principles involved in : 1.sonogram 2. computed tomography 3. digital radiology

A: Sonogram Sonogram is a non invasive medical test or tool used by medical professionals, useful in…

Q: What is the process, from chapter 5, that allowed bacteria cells to acquire new traits? Such as…

A: Traits refer to any characteristic or feature of an organism that is determined by its genes. These…

Q: What is a chromosome? How many chromosomes are in humans? 2.- What are the phases of the cell…

A: Note :- Since you have asked multiple questions im only answering the ist 3 as per bartleby…

Q: The sigma subunit of bacterial RNA polymerase _____. a. binds to a bacterial gene’s promoter b. is…

A: DNA polymerase is an enzyme that catalyzes the formation of new DNA strands from existing DNA…

Concept explainers

Viral Replication

The virus is acellular and considered non-living outside the host cell. The replication of the virus occurs only inside the living cells. Only a few genes are present in the smallest virus, whereas many genes are present in the largest virus. These genes encode specific viral proteins.

Question

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1: Introduction:

VIEW

Step 2: Enzyme required for DNA initiation:

VIEW

Solution

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

In terms of new DNA strands that are generated, what are the differences between replication and conventional polymerase chain reactions?
In terms of the new DNA strands that are generated, what are the differences between replication and conventional polymerase chain reaction?
Why is the replication of DNA referred to as a semiconservative process? What is the experimental evidence for the semiconservative nature of the process? What experimental results would you expect if replication of DNA were a conservative process?
What factors promote the fidelity of replication during the synthesis of the leading strand of DNA? Would you expect the lagging strand to be made with the same fidelity? Why or why not? Explain your answer briefly.
An investigator obtains a bacterial temperature-sensitive mutation that affects a step in the process of DNA replication at 42°C but not at 30°C. She grows the cells at 30°C and, upon shifting the temperature to 42°C, she discovers that Okazaki fragments accumulate in unusually large quantities. What is the likely target affected by the temperature-sensitive mutation? primase DNA polymerase III DNA helicase DNA Ligase DNA gyrase
besides DNA pol I and DNA pol III What are the roles of the other enzymes involved in replication and why they're necessary ?
During DNA replication in E. coli, which enzyme forms the phosphodiester bond between an RNA primer and the first incoming deoxyribonucleotide for an Okazaki fragment on the lagging strand? topoisomerase DNA polymerase III DNA helicase DNA polymerase II DNA ligase
Is it biologically possible for DNA to undergo replication in vivo, without the lagging and the leading strands? In PCR, we also start with an antiparallel strand of DNA. Does this also mean that replication is semi-discontinuous in in vitro replication?
It was once thought that the DNA polymerase machinery moves along DNA in a manner analogous to a train on a track. Current evidence indicates that the polymerizing machinery is instead stationary and that the DNA strands are pumped through the complex. What advantages does this stationary mechanism have?
Why does DNA replication need to be error-free? Why does the DNA need to be a “careful reader?” What is the importance of DNA replication to DNA’s function of storing genetic information?
a) "Out of three E.coli DNA polymerases, DNA polymerases 3 has a high processivity and rate of polymerization and therefore better suited for replication of the genome" What is meant by processivity? how does the DNA polymerase 3 maintain high processivity? b) What is a replication fork ?. Give the protein/enzymes of a replication fork and describe their function?
The DNA polymerase cannot start making a new DNA polymer out of nothing, it needs preexisting nucleic acid to hook the new DNA onto. What is this preexisting nucleic acid called, what enzyme makes it, and what nucleic acid is the preexisting nucleic acid made of?