For the experiment shown Fig. 6.30 and 6.31, what is the advantage to use a labeled incoming nucleotide (α-32P-UTP or α-32P-CTP), not labeled reagent 1 itself? Please draw a diagram to help explain your answer by contrasting the RNA polymerase labeled with α-32P-Reagent (Panel A) vs α-32P-UTP (Panel B). (a)(b)I+Reagent I-OCH₂OH OHPolymerase-NH₂PolymerasePolymeraseNP-o-#fofofo.ZI06-0-O-OCH₂AOH OHP-0--0-0CH₂32p-UTPO OHO=32P-0-OCH2OH OHFigure 6.30 Affinity labeling RNA polymerase at its active site.(a) Structure of one of the affinity reagents (1), an ATP analog. (b) Theaffinity-labeling reactions. First, add reagent I to RNA polymerase.The reagent binds covalently to amino groups at the active site (andperhaps elsewhere). Next, add radioactive UTP, which forms aphosphodiester bond (blue) with the enzyme-bound reagent I. Thisreaction should occur only at the active site, so only that sitebecomes radioactively labeled.U14α1 2 3 4 5 67 8 9 10Figure 6.31 The B-subunit is at or near the active site wherephosphodiester bonds are formed. Grachev and colleagues labeledthe active site of E. coli RNA polymerase as described in Figure 6.30,then separated the polymerase subunits by electrophoresis to identifythe subunits that compose the active site. Each lane representslabeling with a different nucleotide-affinity reagent plus radioactive UTP,except lanes 5 and 6, which resulted from using the same affinity11 12 13 14 15 16 176.4 ElongationB²Вα147reagent, but either radioactive UTP (lane 5) or CTP (lane 6). Theautoradiograph of the separated subunits demonstrates labeling of theB-subunit with most of the reagents. In a few cases, σ was also faintlylabeled. Thus, the B-subunit appears to be at or near thephosphodiester bond-forming active site. (Source: Grachev et al., Studies onthe functional topography of Escherichia col RNA polymerase. European Journal ofBiochemistry 163 (16 Dec 1987) p. 117, f. 2.)

RNA polymerase is a key enzyme in transcription, the process of copying DNA into RNA. To better…

For the experiment shown Fig. 6.30 and 6.31, what is the advantage to use a labeled incoming nucleotide (α-32P-UTP or α-32P-CTP), not labeled reagent 1 itself? Please draw a diagram to help explain your answer by contrasting the RNA polymerase labeled with α-32P-Reagent (Panel A) vs α-32P-UTP (Panel B).

For the experiment shown Fig. 6.30 and 6.31, what is the advantage to use a labeled incoming nucleotide (α-32P-UTP or α-32P-CTP), not labeled reagent 1 itself? Please draw a diagram to help explain your answer by contrasting the RNA polymerase labeled with α-32P-Reagent (Panel A) vs α-32P-UTP (Panel B).

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1ITD: Below is a sequence of 540 bases from a genome. What information would you use to find the...

See similar textbooks

Similar questions

From this overall anticodon sequence in tRNA, 3'-CAUCGGAAUAGAUCGCUAGUGGCAGGCAUAAUGAUCACCGGUCUGAGAAAAGUGGUACAUAUCAAC-5' Using ONE-letter amino acid code starting from N-terminus to C-terminus, what is the amino acid sequence that will be coded for?
Assume the following DNA template strand: 3'-ATA GCG AGG AGT ATC-5' A) What would be the protein associated with this DNA template strand? Give the sequence of amino acids encoded by this fragment. Leave traces of your steps. B) In the synthesis of this protein, what are the codon and the anticodon for? Explain in one sentence for each. C) We find, in another cell, a mutation of this DNA template strand: 3' ATA GCG TGG AGT ATC-5’ 1. What type of point mutation is it? 2. Did this mutation arise during transcription, translation or DNA replication? D) If this mutation is found in a spermatozoon, will it have an effect on the individual, its offspring or both? Briefly explain
which of the following sequences would most likely be able to bind a cyclic amp dna binding protein? (only one strand is shown but assume dna is double stranded) a. 5' atagtcatagtc 3' b. 5' atcggtctcgat 3' c. 5' gctctagcgagc 3' d. 5' atagtaatgata 3'
1- Biochemist Erwin Chargaff was the first to note that, in DNA, [A] = [T] and [G] = [C], equalities now called Chargaff’s rule. With the use of this rule, determine the percentages of all the bases in a DNA molecule which contains 35% thymine. Explain. 2- Similar equalities (i.e. [A]=[U] and [G]=[C]) are however not observed in RNA molecules. Explain the structural differences which dictate why Chargaff rule does not apply to RNA polynucleotides.
From this overall anticodon sequence in tRNA, 3'-CAUCGGAAUAGAUCGCUAGUGGCAGGCAUAAUGAUCACCGGUCUGAGAAAAGUGGUACAUAUCAAC-5' What is the amino acid sequence that will be coded for using ONE-letter amino acid code starting from N-terminus to C-terminus and using THREE-letter amino acid code starting from N-terminus to C-terminus
Original sequence: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ Question: 4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this? 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3
The following sequence is a double stranded DNA. 5'ATTTGACAATGCGTTAGGCATGACTATGTATAATGCATGCCACATACT... 3' 3'TAAACTGTTACGCAATCCGTACTGATACATATTACGTACGGTGTATGA…5' -35 -10 +1 Where does RNA polymerase initially binds?
Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’- GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ By in vitro translating the mRNA, you determined that the translated peptide is 15 amino acids long. What is the expected peptide sequence in single letter abbreviations?
A short RNA molecule was isolated that demonstrated a hyperchromicshift , indicating secondary structure. Itssequence was determined to be5'-AGGCGCCGACUCUACU-3'(a) Propose a two-dimensional model for this molecule.(b) What DNA sequence would give rise to this RNA moleculethrough transcription?(c) If the molecule were a tRNA fragment containing a CGA anticodon,what would the corresponding codon be?(d) If the molecule were an internal part of a message, whatamino acid sequence would result from it following translation?
BIOCHEMISTRY Why is 20% FicollPM-‐400 added to Reverse transcription reaction?
From this overall anticodon sequence in tRNA, 3'-CAUCGGAAUAGAUCGCUAGUGGCAGGCAUAAUGAUCACCGGUCUGAGAAAAGUGGUACAUAUCAAC-5' What is the amino acid sequence that will be coded for using THREE-letter amino acid code starting from N-terminus to C-terminus.
A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a melting temperature (tm) of 59 °C. If an RNA duplex oligonucleotide of identical sequence (substituting U for T) isconstructed, will its melting temperature be higher or lower?