From the above sequence I have copied the first 500bp of the sequence into Word. ATGGTAAAGGCCGTCGTCGGATTCGGCGCTGCATGCGGAATCT CTGCTATCGTTGCTTGCCTTTGGGCTGCACTTGTCATCACAAA TGACATCAATGACATGTATGATGATGTGATGGGAGAGCTCGGA GGATTCAGAGATATCTCTGATGACACTTGGGGAACCCTTCTCG ACGTTCGTCACGGAGCCGGAGAGTCTGCTGAGCAATACGTTCG TGGAATCTTCGGACGTCACAAGCGTTCCAACAGCCAATGCTCT TGCGGACTTCCATCTCAAGGATGCCCAGCCGGAGCTCCAGGAA ACCCAGGAGCCCCAGGAGAGCCAGGAGGCACTGGACCAGACGG AAAGAACGGACCAACTGGACTTCCAGGACTTAACATTCCAATT CCAAATGACTTCCCTAAGGAGTGCATCAAGTGCCCAGCTGGAC CACCAGGACAAGATGGACTTCCAGGACAAGAAGGATTCCAAGG ACTTCCAGGAGACGCTGGAAAGCGTGG 1) You now need to design primers to amplify this 500bp region of the DNA. Write out the primer sequences in the correct orientation. 2) Decide on two restriction sites that you can use to clone this into pL4440's MCS. Identify their sequence. Tip: The plasmid map is in Figure 3, details of restriction site sequences can be found https://enzymefinder.neb.com/#!#nebheader 3) Add the restriction site DNA sequences to the correct end of each primer. 17 promoter L4440 -2,790 bp Amp/ T7 promoter coacCTGATATCATCGAT Sac 1 Sac II Eagl Not at
From the above sequence I have copied the first 500bp of the sequence into Word. ATGGTAAAGGCCGTCGTCGGATTCGGCGCTGCATGCGGAATCT CTGCTATCGTTGCTTGCCTTTGGGCTGCACTTGTCATCACAAA TGACATCAATGACATGTATGATGATGTGATGGGAGAGCTCGGA GGATTCAGAGATATCTCTGATGACACTTGGGGAACCCTTCTCG ACGTTCGTCACGGAGCCGGAGAGTCTGCTGAGCAATACGTTCG TGGAATCTTCGGACGTCACAAGCGTTCCAACAGCCAATGCTCT TGCGGACTTCCATCTCAAGGATGCCCAGCCGGAGCTCCAGGAA ACCCAGGAGCCCCAGGAGAGCCAGGAGGCACTGGACCAGACGG AAAGAACGGACCAACTGGACTTCCAGGACTTAACATTCCAATT CCAAATGACTTCCCTAAGGAGTGCATCAAGTGCCCAGCTGGAC CACCAGGACAAGATGGACTTCCAGGACAAGAAGGATTCCAAGG ACTTCCAGGAGACGCTGGAAAGCGTGG 1) You now need to design primers to amplify this 500bp region of the DNA. Write out the primer sequences in the correct orientation. 2) Decide on two restriction sites that you can use to clone this into pL4440's MCS. Identify their sequence. Tip: The plasmid map is in Figure 3, details of restriction site sequences can be found https://enzymefinder.neb.com/#!#nebheader 3) Add the restriction site DNA sequences to the correct end of each primer. 17 promoter L4440 -2,790 bp Amp/ T7 promoter coacCTGATATCATCGAT Sac 1 Sac II Eagl Not at
Concepts of Biology
1st Edition
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:Samantha Fowler, Rebecca Roush, James Wise
Chapter9: Molecular Biology
Section: Chapter Questions
Problem 15CTQ: Transcribe and translate the following DNA sequence (nontemplate strand): 5’-ATGGCCGGTTATTAAGCA-3’
Related questions
Concept explainers
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
Topic Video
Question
Expert Solution
This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
Step by step
Solved in 3 steps
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Recommended textbooks for you
Concepts of Biology
Biology
ISBN:
9781938168116
Author:
Samantha Fowler, Rebecca Roush, James Wise
Publisher:
OpenStax College
Concepts of Biology
Biology
ISBN:
9781938168116
Author:
Samantha Fowler, Rebecca Roush, James Wise
Publisher:
OpenStax College