From the above sequence I have copied the first 500bp of the sequence into Word. ATGGTAAAGGCCGTCGTCGGATTCGGCGCTGCATGCGGAATCT CTGCTATCGTTGCTTGCCTTTGGGCTGCACTTGTCATCACAAA TGACATCAATGACATGTATGATGATGTGATGGGAGAGCTCGGA GGATTCAGAGATATCTCTGATGACACTTGGGGAACCCTTCTCG ACGTTCGTCACGGAGCCGGAGAGTCTGCTGAGCAATACGTTCG TGGAATCTTCGGACGTCACAAGCGTTCCAACAGCCAATGCTCT TGCGGACTTCCATCTCAAGGATGCCCAGCCGGAGCTCCAGGAA ACCCAGGAGCCCCAGGAGAGCCAGGAGGCACTGGACCAGACGG AAAGAACGGACCAACTGGACTTCCAGGACTTAACATTCCAATT CCAAATGACTTCCCTAAGGAGTGCATCAAGTGCCCAGCTGGAC CACCAGGACAAGATGGACTTCCAGGACAAGAAGGATTCCAAGG ACTTCCAGGAGACGCTGGAAAGCGTGG 1) You now need to design primers to amplify this 500bp region of the DNA. Write out the primer sequences in the correct orientation. 2) Decide on two restriction sites that you can use to clone this into pL4440's MCS. Identify their sequence. Tip: The plasmid map is in Figure 3, details of restriction site sequences can be found https://enzymefinder.neb.com/#!#nebheader 3) Add the restriction site DNA sequences to the correct end of each primer. 17 promoter L4440 -2,790 bp Amp/ T7 promoter coacCTGATATCATCGAT Sac 1 Sac II Eagl Not at

From the above sequence I have copied the first 500bp of the sequence into Word. ATGGTAAAGGCCGTCGTCGGATTCGGCGCTGCATGCGGAATCT CTGCTATCGTTGCTTGCCTTTGGGCTGCACTTGTCATCACAAA TGACATCAATGACATGTATGATGATGTGATGGGAGAGCTCGGA GGATTCAGAGATATCTCTGATGACACTTGGGGAACCCTTCTCG ACGTTCGTCACGGAGCCGGAGAGTCTGCTGAGCAATACGTTCG TGGAATCTTCGGACGTCACAAGCGTTCCAACAGCCAATGCTCT TGCGGACTTCCATCTCAAGGATGCCCAGCCGGAGCTCCAGGAA ACCCAGGAGCCCCAGGAGAGCCAGGAGGCACTGGACCAGACGG AAAGAACGGACCAACTGGACTTCCAGGACTTAACATTCCAATT CCAAATGACTTCCCTAAGGAGTGCATCAAGTGCCCAGCTGGAC CACCAGGACAAGATGGACTTCCAGGACAAGAAGGATTCCAAGG ACTTCCAGGAGACGCTGGAAAGCGTGG 1) You now need to design primers to amplify this 500bp region of the DNA. Write out the primer sequences in the correct orientation. 2) Decide on two restriction sites that you can use to clone this into pL4440's MCS. Identify their sequence. Tip: The plasmid map is in Figure 3, details of restriction site sequences can be found https://enzymefinder.neb.com/#!#nebheader 3) Add the restriction site DNA sequences to the correct end of each primer. 17 promoter L4440 -2,790 bp Amp/ T7 promoter coacCTGATATCATCGAT Sac 1 Sac II Eagl Not at

Name: From the above sequence I have copied the first 500bp of thesequence
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: From the above sequence I have copied the first 500bp of thesequence into Word.ATGGTAAAGGCCGTCGTCGGATTCGGCGCTGCATGCGGAATCTCTGCTATCGTTGCTTGCCTTTGGGCTGCACTTGTCATCACAAATGACATCAATGACATGTATGATGATGTGATGGGAGAGCTCGGAGGATTCAGAGATATCTCTGATGACACTTGGGGAACCCTTCT

Concepts of Biology

1st Edition

ISBN:9781938168116

Author:Samantha Fowler, Rebecca Roush, James Wise

Publisher:Samantha Fowler, Rebecca Roush, James Wise

Chapter9: Molecular Biology

Section: Chapter Questions

Problem 15CTQ: Transcribe and translate the following DNA sequence (nontemplate strand): 5’-ATGGCCGGTTATTAAGCA-3’

See similar textbooks

Similar questions

A 2.0kb bacterial plasmid ‘BS1030’ is digested with the restriction endonuclease Sau3A; the plasmid map is depicted in the diagram below and the Sau3A (S) restriction sites are indicated. Which of the following DNA fragments do you expect to see on an agarose gel when you run Sau3A-digested plasmid ‘BS1030’ DNA? a. 250 bp, 450 bp, 550 bp, 1.1 kb, 1.5 kb and 2.0 kb b. 2.0kb c. 250 bp, 400 bp, 450 bp, 500 bp and 550 bp d. 100 bp, 200 bp, 250 bp, 400 bp, 500 bp and 550 bp
This plasmid was digested using different restriction enzymes whose sites have been mapped. The plasmid is 7896 base pairs long. This is a long question so u can count this as two or even three but please answer the question? Determine the size (base pairs) and number of fragments that would be produced if the plasmid was digested with the following enzymes: a) EcoRI b) BamHI c) HindIII d) EcoRI and HindIII e)EcoRI, HindIII, and BamHI *Hint- this is actually an EASY question, since the restriction map is already drawn for you!
You have a recombinant plasmid containing a vector and a segment of foreign DNA, both equal sizes. Draw a picture of this recombinant plasmid labeling foreign and vector regions. Where the foreign DNA meets the vector, there is a cut site for restriction enzyme ABC1. When the recombinant plasmid is cut by ABC1, how many fragments do you expect to be produced? Identify these fragments.
Restriction sites are palindromic; that is, they read the same in the5' to 3' direction on each strand of DNA. What is the advantage ofhaving restriction sites organized this way?
The map of plasmid pUC19 is shown below. The restriction site coordinate is the position of the 5’base on the top strand of each site sequence. The restriction enzyme sites are in bold type if there is only one site in pUC19. Please list the fragments in order of size, largest to smallest, which will result from a complete digestion by the restriction enzyme PvuII. Please list the fragments in order of size, largest to smallest, which will result from a complete digestion by the restriction enzyme DrdI.
Assume that a circular plasmid is 3200 base pairs in length and has restriction sites for HindIII restriction enzyme at the following locations: 400, 700, 1400, 2600. Give the expected sizes of the restriction fragments following complete digestion.
U have the plasmid pUC18/19, which is a circular plasmid that consists of 2686 bp. What would the number of and length of the fragments be if you cut the plasmid with the following restriction enzymes or combination of enzymes? Give a schematic representation of the digestions. PscI & GsuI ______________________________________________________________ ScaI, PdmI & BsaXI ______________________________________________________________ ScaI, SspI & EheI ______________________________________________________________
For the following short sequence of double stranded DNA, design primers (just ~ 3-4 bases) and show 2 copy cycles of PCR (refer to figure 13.25) for the amplification of this sequence of DNA (so that you have 4 double stranded DNA). 5’- GGTATTGGCTACTTACTGGCATCG- 3’ 3’- CCATAACCGATGAATGACCGTAGC- 5’
A plasmid has two restriction cut sites for EcoRI and one restriction cut site for HindIII. The plasmid is subjected to PCR, and the region containing the three restriction cut sites is amplified, such that all three sites are present in the resulting amplicon. If the amplicon is incubated with EcoRI, how many fragments of DNA are expected to result from this digest experiment? a. 0 b. 1 c. 2 d. 3 e. 4
Below is a map of the E. coli cloning vector after the insertion of pka-1. Ori denotes the origin of replication; amp denotes the ampicillin resistance gene. HindIII, BamHI, SalI, and EcoRI designate restriction enzyme sites. There are no other restriction enzyme sites found on this vector. The numerals denote the number of base pairs between different locations on the plasmid. For instance, there are 400 base pairs between the HindIII and BamHI site, and there are 3000 base pairs in the entire cloning vector (following the integration of pka-1). With the use of well-illustrated diagrams, reconstruct the entire cloning process by explaining different stages of the cloning process that involves the following: Isolation of target DNA fragments (often referred to as inserts) Ligation of inserts into the plasmid, creating recombinant molecules Transformation of recombinant plasmids into bacteria or other suitable host for propagation Screening/selection of hosts containing the intended…
You wish to amplify a segment of DNA from a plasmid template by PCR with the use of the following primers: 5’-GGATCGATGCTCGCGA3' and 5' -AGGATCGGGTCGCGAG-3'. Despite repeated attempts, you fail to observe a PCR product of the expected length after electrophoresis on an agarose gel. Instead, you observe a bright smear on the gel with an approximate length of 25 to 30 base pairs. Explain these results.
In relation to the use of restriction enzymes in recombinant DNA technology, answer the following: You have accidentally torn the labels off two tubes (tube A and tube B), each containing a different plasmid, now you do not know which plasmid is in which tube. Fortunately, you have restriction maps for both plasmids, shown in Figure below. You have the opportunity to test just one sample from one of your tubes. By utilizing agarose gel electrophoresis technique, which restriction enzyme OR combination of restriction enzymes would you use in this experiment to determine which plasmid is found in which tube?. (Hint: if you use Hind III restriction enzyme you are going to get ONE single fragment with a molecular size of → 0.5+0.3+0.2+0.4+1+1 = 3.4 kb).