Answered: Given the following mismatch…

Given the following mismatch (highlighted in red), which base will be replaced after mismatch repair occurs? Mutant sequence (CH3 = methyl): CH3 I 5'-GATCTCAGGC-3' 3;-CTAGAGGCCG-5' a. G b. A

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 3QP: If the genetic code used 4 bases at a time, how many amino acids could be encoded?

See similar textbooks

Related questions

Q: Which of the following set(s) of primers a–d couldyou use to amplify the following target DNA…

A: Cystic fibrosis is a hereditary disease, inherited in an autosomal recessive manner. The cystic…

Q: Hydroxylamine (NH2OH) converts cytosine to the compound shown below. With which base does this…

A: Transition mutation refers to a point mutation that changes a purine nucleotide to another purine or…

Q: 5' AU Py U A AGGCC G. UGGC G C G GGG What modified nucleoside base is indicated by the arrow?…

A: The answer of the above question is : Pseudouracil (Ψ). Pseudouridine (psi- Ψ)is an isomer of the…

Q: The following sequence has been mutated as follows. What type of mutation is this? Original DNA: 3'…

A: Biological macromolecules are those large molecules that are necessary for the survival and growth…

Q: The Universal Genetic Code Table can be used to determine the gene product of a given nucleotide…

A: mRNA consist of mononucleotide sequence that specifies amino acids sequence in peptide chain. One…

Q: The base analog 5-bromouracil undergoes tautomerization. One tautomer behaves like thymine, and the…

A: Solution (5-Bromoracil comes in three tautomers, each with its own set of properties. Adenine is…

Q: For a linear B-DNA molecule of 50,000 kb, calculate (a) the contour length and (b) the length of the…

A: The complexity of an organism is based on the functioning of its genome. Deoxyribonucleic acid (DNA)…

Q: Which primer would be appropriate to amplify the top strand of the DNA molecule shown? 5'…

A: Polymerase chain reaction is a method widely being used to make multiple copies of the same DNA…

Q: How often, on average, would you expect a type II restriction endonuclease to cut a DNA molecule if…

A: Restriction endonucleases are enzymes produced by bacteria that cut the DNA at a specific site known…

Q: A small section of bacterial DNA antisense strand has the following nucleotide sequence: AAT CGG…

A: Option d

Q: What would be a primer sequence synthesized from the following DNA sequence: 5'-ACGTG-3'? out of…

A: DNA polymerase cannot start DNA replication on its own. They require short double stranded region to…

Q: Choose the combination of answers that most accurately completes the statement.Which of the…

A: Restriction endonuclease or restriction enzyme is a type of enzyme used in cloning studies. It is…

Q: DNA repair enzymes that correct deamination and depurination must preferentially recognize these…

A: DNA damage occurs when negative changes occurs in DNA due to endogenous or exogenous factors, The…

Q: If hypoxanthine (structure shown) was incorporated into double stranded DNA, what would it most…

A: Hypoxanthine is a non-natural base that is found in the DNA. DNA is also known as deoxyribonucleic…

Q: Which form of flavin adenine dinucleotide is the "reduced" form, FAD or FADH2? Explain

A: Flavin Adenine Dinucleotide: It is a redox active coenzyme associated with various proteins, which…

Q: In a standard procedire, when writing and reading base sequences for nucleic acids (both DNA and…

Q: Why are the activated nucleotides in nucleic acid polymerization reactions 5’-triphosphates?

A: According to the question, we have to explain the reason for the activated nucleotides in nucleic…

Q: The DNA of a deletion of alpha bacteriophage has a length of 15 micrometers instead of 17…

A: The bacteriophage is those viruses that have the capability to infect bacteria and reproduce inside…

Q: A DNA probe with sequence TCAGGCTTCAG would bind most strongly to which of the following DNA…

A: Gene probes are small, single-stranded DNA or RNA that hybridize with the target DNA sequences in a…

Q: Given the Following DNA template, TAC CGC TCC GCC GTC GAC AAT ACC ACT, write out the…

A: The DNA template is used for the synthesis of mRNA molecules. mRNA molecule is used by the…

Q: Where would you expect DNA-binding proteins to bind if they recognize a specific base sequence? What…

A: Deoxyribonucleic acid (DNA) is a hereditary molecule that transfers genetic information from one…

Q: The TM of a DNA duplex is measured at 55 C. When the concentration is one thousand times higher, the…

A: The Temperature of Melting (Tm) is defined as the temperature at which 50% of double stranded DNA is…

Q: . A mutational lesion results in a sequence containing amismatched base pair:5′ AGCTGCCTT 3′3′…

A: Mismatch repair : It is a system for recognizing and repairing wrong insertions, deletions and…

Q: Consider the following coding sequence transcribed from 5' to 3' 5' A T G A A G C G C T C A G T A 3'…

A: Substitution of guanine at position 11 would result in to conversion of UCA into UGA (which is a…

Q: If the code were a sextuplet (containing of six nucleotides), would the reading frame be restored by…

A: A frameshift mutation is induced by adding or deleting several nucleotides in a DNA sequence that is…

Q: Why are GC and AT the only base pairs permissible in the double helix?

A: Base pair: The nucleotides on opposite strands of DNA double helix, that form chemical bonds…

Q: For a protein-DNA binding reaction with ΔH = 0, sketch the van’t Hoff plot, label both axes.

A: Van't hoff equation gives the relationship between equilibrium constant, temperature, and enthalpy…

Q: A closed circular duplex DNA has a 100-bp segment of alternating C and G residues. On transfer to a…

A: B-DNA IS BIOLOGICALLY THE MOST COMMON –RIGHT-HANDED (20 ANGSTROM (A) DIAMETER) –COMPLEMENTARY…

Q: Mismatch repair in E. coli distinguishes between old and new strands of DNA on the basis of a.…

A: Deoxy ribonucleic acid (DNA) is the genetic material of most organisms that carry coded genetic…

Q: For the following sequence, what is the Tm? 5'-AGCTACGATCAGGTCA-3'

A: Polymerase chain reaction (PCR) is a technique to amplify the sequence of DNA. A large quantity of…

Q: Give the sequence of unpaired bases that would be sticky with the following sequences:(a) GGTAC (b)…

A: Restriction endonucleases may cut DNA. The ends of the DNA may be blunt or sticky. A straight cut…

Q: A lagging strand is sketched below. The Okazaki fragment DNA is red, and the RNA primers are dashed…

A: Introduction: DNA stands for 'deoxyribonucleic acid' and it is the hereditary material in humans and…

Q: B D A E 1. The RNA primer is denoted by letter 2. The leading strand is denoted by letter 3. The…

A: The DNA replication involves synthesis of new DNA from the old DNA by semiconservative mode. The DNA…

Q: In the given segment 3 ’ C A G T T A C G G C T C C T A G G T T A T A A T T C G T T T C 5 ’…

A: DNA replication occurs with the help of several enzymes and is always synthesized in 5' to 3'…

Q: Why are okazaki fragments necessary on the lagging strand?

A: In a long DNA molecule, since the the two strands of DNA cannot be separated in its entire length…

Q: Cytosine

A: Introduction :- A mutation occurs when a DNA gene is damaged or changed in such a way as to alter…

Q: Which of the following base pairs is/are not possible in B-DNA?

A: DNA is present in several different forms, such as A, B, and Z forms. Out of these, the B form is…

Q: Why is the AT base pair less stable than the GC base pair

A: DNA is a genetic material present in most living organisms and it is composed of nucleotides.…

Q: For each of the heterocyclic bases, choose a correct characterization from the response list…

A: Nucleic acids are the polymer of nucleotides. Nucleotide is made up of ribose or deoxyribose sugar,…

Q: Give 3 strand slippage and trinucleotide repeat disorder examples

A: DNA is the source of genetic information. It transfers genetic information from parents to…

Q: Hhal is a 4-cutter restriction enzyme that creates 2-base, 3' overhangs ("sticky ends") and…

A: Restriction enzymes can cleave the DNA sequences at the recognition sites, also known as restriction…

Q: When the cDNA was sequenced by the Sanger method utilizing ddCTP, the following products were…

A: Answer :: If the dCTP was not present, the polymerization would come to a standstill, resulting…

Q: plz explain with thorough explanation

A: Introduction : The physical appearance of an organism such as colour, height, which occurs as a…

Q: Are the following base sequences sticky or not sticky? Each piece is written 5′ to 3′.(a) TTAGC and…

A: A base is nitrogen containing heterocyclic compound which, is found in DNA and RNA. There are…

Q: Which of the following sequences would most likely be able to bind a Cyclic AMP DNA binding protein?…

A: Cyclic AMP or cAMP is one of the most important secondary messenger prevalent in biochemical signal…

Q: Consider the following sequence of DNA: 3'-AGA CCC-5'. a. What dipeptide is formed from this DNA…

A: Mutations can be the change in the sequence of DNA and RNA, and mutations can be caused by a…

Q: AAGTCAAGAAGAAGAAGAAGCC A. The nucleotide sequence above is a STR of how many repeats? B. What…

A: Short Tandem Repeats(STR) or microsatellites or simple sequence repeats(SSR) are short sequences of…

Concept explainers

Tissue regeneration & repair

Tissue regeneration involves the restoration of tissue components by regrowth of damaged tissues. In contrast, tissue repair involves patching of injured tissue rather than restoring it. It is the proliferative capacity of the cells that decides the amount of regeneration against the repair that would occur in the tissue. Both regeneration and repair depending on the duration of the injury and response to the inflammation.

Question

Given the following mismatch (highlighted in red), which base will be replaced after mismatch repair occurs?

Mutant sequence (CH₃ = methyl):

CH₃

5'-GATCTCAGGC-3'

3;-CTAGAGGCCG-5'

a. G

b. A

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

In the following sequence, a cytosine was deaminated and is now a uracil (underlined). 5’-GGTAUTAAGC-3’ a. Which repair pathway(s) could restore this uracil to cytosine? b. If the uracil is not removed before a DNA replication fork passes through, what will be the sequences of the two resulting double helices? Provide the sequences of both strands of both helices. Label the old and new strands and underline the mutation(s). c. Could the mismatch repair pathway fix the mutations you’ve indicated in part b? d. If the cell undergoes mitosis, and the replicated DNAs are distributed into the two daughter cells. Will 0, 1, or 2 daughter cells have a mutation in this sequence?
Hydroxylamine (NH2OH) converts cytosine to the compound shown below. With which base does this modifi ed cytosine pair? Does this generate atransition or a transversion mutation?
. A mutational lesion results in a sequence containing amismatched base pair:5′ AGCTGCCTT 3′3′ ACGATGGAA 5′CodonIf mismatch repair occurs in either direction, whichamino acids could be found at this site?
Deamination of adenine results in the formation of hypoxanthine. Hypoxanthine selectively base pairs with cytosine. If this error is not corrected, what base pair can the original A·T base pair be converted to after cycles of DNA replication?a) G·C b) C·G c) T·A d) A·G
Which of the following set(s) of primers a–d couldyou use to amplify the following target DNA sequence, which is part of the last protein-coding exonof the CFTR gene?5′ GGCTAAGATCTGAATTTTCCGAG ... TTGGGCAATAATGTAGCGCCTT 3′3′ CCGATTCTAGACTTAAAAGGCTC ... AACCCGTTATTACATCGCGGAA 5′a. 5′ GGAAAATTCAGATCTTAG 3′;5′ TGGGCAATAATGTAGCGC 3′b. 5′ GCTAAGATCTGAATTTTC 3′;3′ ACCCGTTATTACATCGCG 5′c. 3′ GATTCTAGACTTAAAGGC 5′;3′ ACCCGTTATTACATCGCG 5′d. 5′ GCTAAGATCTGAATTTTC 3′;5′ TGGGCAATAATGTAGCGC 3′
which of the following sequences would most likely be able to bind a cyclic amp dna binding protein? (only one strand is shown but assume dna is double stranded) a. 5' atagtcatagtc 3' b. 5' atcggtctcgat 3' c. 5' gctctagcgagc 3' d. 5' atagtaatgata 3'
The DNA of a deletion of alpha bacteriophage has a length of 15 micrometers instead of 17 micrometers? How many base pairs are missing from this mutant?
For the following sequence please design an 18 base pair REVERSE primer. ATG TCA AAA GCT GTC GGT ATT GAT TTA GGT ACA ACA TAC TCG TGT GTT GCT CAC TTT GCT TAA
Are the following base sequences sticky or not sticky? Each piece is written 5′ to 3′.(a) TTAGC and GCTAA(b) CGTACG and CCTTCG
What would be a primer sequence synthesized from the following DNA sequence: 5'-ACGTG-3'? out of 5'-GTGCA-3', 5'-CACGT-3', 5'-CACGU-3', 5'-TGCAC-3', or 5'-ACGTG-3'?
Why is the AT base pair less stable than the GC base pair?
Cytosine can be deaminated to form Uracil What type of mutation is this classified as? Discuss what happens to the base-pairing properties from switching from C to U? When U is replicated in two rounds of synthesis, what substitution does this result in? Before Uracil alters the DNA during replication, what repair system can be used to correct this error? Describe how this type of DNA repair works?