Given the Ramachandran Plot below, identify the protein components that could adopt the phi-psi angle combination indicated by the number 3.
Q: If there is an accumulation of acetyl CoA in the liver mitochondria, acetyl CoA is converted to…
A: Acetyl-CoA is formed from the end product of glycolysis i.e. pyruvate and then participates in TCA…
Q: Consider the complete oxidation of one mole of simple TAG containing behenic acid residues (22:0).…
A: Behenic acid is a saturated fatty acid with 22 carbon atoms and possesses the general formula,…
Q: Calculate the unknown concentration of the PROTEIN B with an absorbance value of A358 given the…
A: Tp calculate the unknown concentration of protein B from absorbance value, we first need to plot a…
Q: High amount of citrate decreases the activity of fructose 1,6-bisphosphatase. True or False
A: Fructose 1,6-bisphosphatse enzyme participates in gluconeogenesis and gluconeogenesis is a pathway…
Q: he amino acid alanine, shown below, contains all of the following functional groups except A. an…
A: Amino acids are the building blocks of proteins which are composed of amino group (NH3+), carboxyl…
Q: Lipids play a role as the building block of cell structure. Suggest and discuss another two…
A: Lipids are organic substances that are insoluble in water and soluble in organic solvents like…
Q: What exactly are pseudovitamins? What distinguishes them from vitamins? Compare these two in terms…
A: Vitamins are chemical molecules that people require in little amounts. Most vitamins must be…
Q: Macromolecule Carbohydrates CH₂OH H OH H H OH H HO Lipids QOH HHHH HH My HH Monomer(s)/ Subunit(s)…
A: Biomolecules are carbon-based organic compounds produced by living organisms. They are made up of…
Q: what will be the effect of hot dry conditions in the carboxylase activity of RuBisCO?
A: Introduction: RUBISCO (ribulose 1,5 bisphosphate carboxylase/oxygenase) is an enzyme present in…
Q: Consider fatty acids from the hydrolysis of the given TAG in a liver cell where amino acid and…
A: Fatty acid oxidation is the process in which long chain fatty acids are converted into acetyl-CoA.…
Q: Carbohydrates are biomolecules are complex molecules whose building block is the ___________.…
A: Carbohydrates, lipids, proteins, and nucleic acids are the four major biomolecules. All of these…
Q: Lipids like nucleic acids and proteins are made of strings of similar subunits. True or false.…
A: The four classes of biological macromolecules are lipids proteins, nucleic acids and carbohydrates.…
Q: Postulate reasons as to why some bands are higher in intensity (thicker) than others for sample in…
A: Introduction: Gel electrophoresis is a technique that is commonly used to separate proteins based…
Q: Explain how the oxygen dissociation curve is related to the properties and function of hemoglobin
A: Introduction: Hemoglobin is a globular protein with four polypeptide chains bonded together. It has…
Q: Is the following statement true or false?: Saturated fats have higher melting point than unsaturated…
A: Fatty acids are the simplest form of lipids/ They are long-chain hydrocarbons with one carboxyl…
Q: Do adrenaline rush promotes glycogenesis?
A: Adrenaline is also known by the name epinephrine. This hormone is referred to as the type of stress…
Q: What is the complete base composition of a double stranded eukaryotic DNA that contains 24%…
A: DNA is a nucleic acid that is composed of nucleotide units. Each nucleotide unit is composed of a…
Q: H-C FADH₂ FAD H₂O COO™ 1 C-H COO™™ Fumarate ADP ATP COO™ HO–CH CH₂ COO™ Malate NAD COO™ CH₂ CH₂ COO™…
A: TThe citric acid cycle (CAC) is the key metabolic pathway responsible for the oxidative degradation…
Q: (3) What is a protein database? Give examples (and links) of some protein database
A: Bioinformatics is described as the application of tools of computation as well as the analysis to…
Q: Identify what type of micropipette should be used to accurately transfer the volume in the ITEM 10…
A: micropipeptes are used to dispense liquids in microliters volumes.
Q: How many molecules of NADPH are needed to fix 1 molecule of carbon dioxide? Group of answer…
A: Carbon dioxide is fixed during the photosynthesis process. In photosynthesis, the carbon dioxide is…
Q: Explain the mechanism of action of carnitine in losing weight? (Lipid Metabolism)
A: Carnitine is a nutrient that is found in many foods (especially meat and dairy products) and is made…
Q: Lipolysis involves the hydrolysis of glycolipids. O True False
A: Lipolysis is the metabolic process that hydrolyzes lipid triglycerides into glycerol and fatty…
Q: in every Acetyl CoA entering ETC, how many ATPs are produced?
A: Glycolysis as well as the TCA cycle both are processes involved in cellular cellular metabolism. In…
Q: e. Triacylglycerols and glycerophospholipids both contain fatty acids and saponifiable. True False…
A: Triacyl glycerols are the esters of fatty acids attached to Glycerol. GlyceroPhospholipids are…
Q: We saw that GPCRs have a basal level of constitutive activity. Not all receptors do. Why might…
A: Introduction: G-protein coupled receptors (GPCRs) are also known as seven-membrane domain…
Q: The glycosaminoglycan polysaccharide chainsthat are linked to specific core proteins to form the…
A: Proteoglycans are the proteins bound to glycan units that are mainly amino and uronic acid…
Q: Please dont copy Summarize the phases of oxidative phosphorylation starting with ETC receiving…
A: The final step in cellular respiration is oxidative phosphorylation. It takes place in the…
Q: As soon as lysis occurs, proteolysis, dephosphorylation and denaturation begin. These events can be…
A: Cell lysis is a process in which cells membrane are ruptured and all constituents are released. It…
Q: Identify (1) the group where the lipid belongs, and (2) determine whether the lipid is saponifiable…
A: Lipids are amphipathic molecules which means they have both polar and polar groups present in their…
Q: Two molecules of ATP and 4 molecules of GTP are consumed to produce one molecule of glucose in…
A: Gluconeogenesis is a reverse pathway of glycolysis. In this pathway, glucose is synthesized from…
Q: Briefly discuss the effect of salt, pH and temperature on the action of salivary amylase. Then, list…
A: Salivary amylase breaks down complex carbohydrates into smaller pieces. The activity of salivary…
Q: long can a radiation worker stay in a 15 mSv/hr radiation field if we limit a dose to 1 mSv?
A: Stay time = Limit/ Dose rate To calculate the stay time, we must convert millisievert (Sv) to mrem.…
Q: Make a mind map for cellular respiration
A: Cellular respiration is a process which involve metabolic reactions taking place in cells. These…
Q: Give one condition for the denaturation step employed in blotting.
A: one condition for the denaturation step employed in blotting
Q: Kindly Draw the structure of the lipids present in pig's brain.
A: Introduction: Lipids are a heterogeneous group of compounds that insoluble in water but soluble in…
Q: All the reactions involved during gluconeogenesis occur in the cytosol except the one catalyzed by…
A: Including in non-photosynthetic living things, gluconeogenesis is a principal mechanism that results…
Q: describe the amines of the carbonyl functional group. Include the difference between primary,…
A: Amines are the organic compounds which have a nitrogen atom with lone pair of electrons. These are…
Q: Please state if the statements are true or false. 1. A furanose is a sugar in the Haworth…
A: Carbohydrates, often known as sugar molecules, are a type of molecule. Carbohydrates are one of the…
Q: Which of the following stimulates glycogen synthesis?
A: Glycogen is a multibranched polymer of glucose used by mammals, fungi, and bacteria to store energy.…
Q: 1. Arabinose is a pentose and an aldose 2. Glucose-6-phosphate cannot leave cell because its size is…
A: The Arabinose is a type of sugar or saccharide ,it is further classified as monosaccharide . Glucose…
Q: briefly explain the importance of the protein factor EF-Ts in the translation process. do not simply…
A: EF-Ts is a protein factor used during elongation in prokaryotes. Elongation process in…
Q: 1. ATP ACCOUNTING Provide what is being asked for. Show all relevant calculations and summarize your…
A: Complete Oxidation of odd numbered fatty acids like 17:0 fatty acid (given in the question) requires…
Q: What mode of chromatographic separation (RPLC, NPLC, HILIC, SEC, IEX) is best used for the specified…
A: Chromatography is an analytical method used in chemical analysis to separate a mixture into its…
Q: Discuss the synthesis and breakdown of glycogen and how the processes are regulated in response xto…
A: Glycogen is a homopolysaccharide. glycogen has α1-4 glycosidic bond in linear eight to ten…
Q: was diagnosed with osteoporosis («porous bones»). Osteoporosis is a common cause of fractures of the…
A: Osteoporosis causes bones to become brittle and weak, to the point where a fall or even little…
Q: What are the application of human genome(not human genome project) into health, biochemistry, and…
A: Human genome comprises of human's nucleic acid sequences that are encoded only in form of DNA. This…
Q: 8. Consider the biosynthetic pathways by which 'fatty acids, steroids, carbohydrates and amino acids…
A: Fatty acids, steroids, carbohydrates and amino acids are the biomolecules which are required for the…
Q: Generation of induced pluripotent stem (iPS)cells was first accomplished using retroviral vectors…
A: Induced pluripotent stem cells that are also referred asiPSCs are generated only from…
Q: In centrifugation, the components of a given mixture are subjected to CENTRIFUGAL force, which…
A: Cell organelles include mitochondria, nuclei, vacuoles, ribosomes, plastids, peroxisomes, and…
Given the Ramachandran Plot below, identify the protein components that could adopt the phi-psi angle combination indicated by the number 3.
Step by step
Solved in 2 steps
- Given a primer sequence 3’- CTGGGAAACATTCTGGAT - 5’, compute for the melting temperature of this 18-mer.Drew the peptide sequence and write its full name Cys-Gln-Lys-His-Ala-Ser-Gln20-92 How many different primary structures are possible for a four-amino-acid segment of a protein if three of the amino acids present must be identical the four amino acids must be different
- Ala-Phe-Pro-Cys-Clu-Arg-Arg-Pro-His-Gly-Lys-Clu Calculate the net charge on the polypeptide at a. pH 1.5 b. pH 8 c. pH 13What does BCR ABL stand for?HpaI --- 5' GTT - AAC 3'5' GGATGTTAACAATCTCTACGGGTTAACACCCTTGGGTTAACATCCGCGG 3' 3' CCTACAATTGTTAGAGATGCCCAATTGTGGGAACCCAATTGTAGGCGCC 5' Number of pieces of DNA____