Q: Functional Group Name Structural Diagram (draw all bonds) Found where in the body??? Hydroxyl H -N H...
A: Functional groups can be described as the groups of molecules that get linked to organic molecules a...
Q: Preparing plasmid (double-stranded, circular) DNA for sequencing involves annealing a complementary,...
A: The process of joining of single-stranded DNA or RNA by hydrogen bonds to form a double-stranded pol...
Q: explain the scope of practice for EMTs in arizona. Is the scope of practice dictated by the state ...
A: Scope of Emergency medical technician is good in Arizona. Avg salary per hour for emt in arizone is...
Q: Aerobic Respiration Chart Aerobic Respiration Location (Euk/Pro) ATP ATP used produced Type of produ...
A: Aerobic respiration is a process of cellular respiration takes place in the presence of oxygen to pr...
Q: Bacterium is gram positive, bacillus, single, short chain. How to determine the bacterium step by st...
A: **As per our guideline, we are supposed to answer only three sub-parts of a question. Please repost ...
Q: Sea urchin development. Basic features of the formation of the axes: A-P & L-R and the role of micro...
A: EMT/Ingression - Epithelial mesenchymal transition is a crucial process for placing the mesoderm ben...
Q: embryos are exposed to this drug during an early stage of organogenesis, they develop severe skeleta...
A: Hox genes are involved in embryonic development as well as in mechanisms in the adult body , thus it...
Q: In a population with high resource value relative to cost (V =2*C), which strategy is considered a p...
A: The populations showing low resource value (V< C) relative to cost (C), the hawks and dove can be...
Q: Explain the importance of the protein structures (from its primary to quaternary structures) in thei...
A: Introduction:- The amino acid sequence and local, low-energy chemical bonding between atoms in the p...
Q: If the template DNA sequence is 3' - CCC - ATA - GAG - AAA - 5' , then what is the corresponding dau...
A: DNA is molecule which is present inside a cell and contain the genetic information of an individual ...
Q: An epitope associates with which part of an antigen receptor?
A:
Q: In 2018, 8,533 new cases of Human Immunodeficiency Virus (HIV) infection were reported in the Philip...
A: The human immunodeficiency viruses incidence is expressed because of the calculable variety of perso...
Q: Select all the statements that provide evidence that DNA is the genetic material. Check All That App...
A: The eukaryote chromosome is linear and contains both DNA and protein, and both are found in equal ma...
Q: They have purified a 1100 bp HindIII restriction fragment that they plan to sequence. As a first ste...
A: EcoR1: EcoR1 is a restriction endonuclease enzyme found in the E. coli bacteria. It's a restriction...
Q: Pancreatic juices, saliva, and bile are used only for mechanical digestion? A. True B. False
A: Mechanical digestion comprises physically breaking down food items into smaller chunks in order for ...
Q: Discuss the mechanism that leads to aggregation of a protein therapeutic via a conformationally-alte...
A: Misfolded proteins acquire a shape that causes polymerization into aggregates and structured fibrils...
Q: What roles do membrane proteins play in cell interactions?
A: The direct contacts between cell surfaces that are important in the formation and function of multic...
Q: How does modification of the insect legs/limbs better equip the insect to survive in a given environ...
A: Insects are adapted their environment in many ways. An adaptation is an adjustment to the environmen...
Q: Perichondrium is
A: Perichondrium is layer of connective tissue that surrounds the cartilage of developing bone. It con...
Q: How has having an opposable thumb helped primates, especially humans, adapt to their environment and...
A: The opposable thumb is an adaptation that helps humans and other primates to carry out the tasks the...
Q: 6. In Drosophila melanogaster, the wild-type eye colour is dark red. A pure-breeding mutant strain w...
A: Introduction :- The term "purebred" refers to offspring that are the consequence of a real breeding....
Q: Round seed is dominant over wrinkled. Yellow cotyledon is dominant over green. Full pod is dominant ...
A: In this question, it is not mentioned whether it is dominant homozygous or dominant heterozygous. To...
Q: Which of the following is NOT a defining chordate characteristic? O post-anal tail O vertebrae O pha...
A: Chordate characteristics include presence of notochord, a dorsol hollow nerve cord and paired pharyn...
Q: A B Mega gametophyte H. M K F G E LL
A: Heterosporous vascular plants are consisted with the vascular tissues along with two types of spores...
Q: _______are always changed by participating in a reaction. a. Enzymes c. Reactants b. Cofactors d. Co...
A: A reaction involve different substances to provide a desired product. It plays important role in eve...
Q: Draw the portion of the specimens where it shows where their specialized structure is located and in...
A: Kalanchoe Kalanchoe representing crassulacean acid plants (CAMP.) which are recognized as a photosy...
Q: 5. A cross between two wild-type flies gave progeny all of which were wild type. When vg e flies the...
A: Introduction: Test cross refers to a genetic cross between a homozygous recessive individual and a c...
Q: Enumerate clinically relevant parasites that can be visualized using the Kato-Katz method in a clini...
A: The most prevalent method of gastrointestinal infection is the contamination of water, food, and han...
Q: A young boy is color blind. His one brother and five sisters are not. The boy has three maternal unc...
A: Introduction: Colour blindness, also known as colour vision deficit, is the inability or reduced cap...
Q: 5. In German cockroaches, bulging eyes (bu) are recessive to normal eyes (bu*), and curved wings (cv...
A: Linkage is the close association of genes or other DNA sequences on the same chromosome. The closer ...
Q: You come across four polynucleotide strands. The first is an original RNA strand that codes for a pr...
A: A mutation occurs when the sequence of DNA changes. Mutations can occur as a result of DNA copying e...
Q: Compare and contrast mitosis and meiosis. In what ways is meiosis II similar to and different from ...
A: There are two types of cell division: Mitosis Meiosis
Q: hybridization production of antibiotics vaccine development transgenic animals transgenic plants pro...
A: Recombinant DNA technology(RDT) is widely used in plant tissue culture, animal cell culture,medicine...
Q: Translate this RNA transcript: 5' - UUUCUUAUGUGUCGCCGUAAUUGAUAUUAC - 3'. O Phe-Leu-Met-Cys-Arg-Arg-I...
A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: Tra...
Q: How can we correlate the activity” ESTIMATION OF ENERGY FLOW FROM PLANT TO HERBIVORE” to laws of the...
A: Autotrophs and heterotrophs are classifications of organisms based on the type of energy and nutrien...
Q: what is sex ? and what is anal sex ?..
A: Sexual intercourse is a reproductive act in which male reproductive organ enters female reproductive...
Q: he following data were obtained from the thyroid uptake study of a patient after administration of I...
A: According to the data provided, the percentage of thyroid uptake of the patient after administration...
Q: Question # 138 A 53-year-old man comes to the office because of difficulty reading fine print over t...
A: B. Lens elasticity is most likely abnormal in this patient. The lens of the eyes needed to see objec...
Q: How is knowledge on the origin of the insect alimentary canal assist one in understanding each div...
A:
Q: For each of these things, say whether it describes the coding sequence or the regulatory sequence. T...
A: Coding sequences are sequences or portions of a gene or mRNA which codes for a protein. The coding r...
Q: Does the ATP synthase protein complex have to be located precisely on the membrane in relation to wh...
A: Plants and many other photosynthetic microorganisms use sunlight to generate food and energy. This ...
Q: What are the two main types of transport proteins? What are their functions?
A: The act or means by which a molecule or ion is transferred across the cell membrane or through the b...
Q: Isovolumetric contraction" is a phase in the cardiac cycle in which the volume of a particular heart...
A: Isovolumetric contraction" is a phase in the cardiac cycle in which the volume of a particular heart...
Q: Explain this assertion using the example of hematoxylin and eosin staining.
A: Hematoxylin and eosin staining is used for identification of diseases like cancer. These are two dye...
Q: From 25 samples, each with size 10, you estimated that the hospital's EHR downtime average time was ...
A: An EHR, or Electronic Health Record, is a comprehensive system that allows a physician to keep track...
Q: Multiple Alleles:
A: Given: Gene mutations may produce many different alleles of a gene. Some genes may have as many as 3...
Q: How does modification of the insect legs/limbs better equip the insect to survive in a given environ...
A: Introduction :- Modifications are alterations or differences in the DNA of organisms of the same spe...
Q: describe and demonstrate the digestive, breathing, and circulation processes and integrate it with t...
A: Energy required to do all the activities of the body is derived from food . Digestive system allows ...
Q: Which statement best describes the primary difference between bacteria and protists? In terms of cel...
A: Correct statement is In terms of cellular organization, bacteria are single-celled microbes and are...
Q: Please discuss pathogenicity and the mechanisms by which microorganisms can attack the human body.
A: Any condition in which the body's normal structure or functioning is damaged or hindered is referred...
What is the reason why is it best to examine a freshly collected stool sample in clinical parasitology laboratory?
Step by step
Solved in 3 steps
- What is the purpose of examining a specimen slide containing a stool sample in a clinical parasitology laboratory in a systematic manner?Why is it best to examine a freshly collected stool sample in clinical parasitology laboratory? Please answer in your own words, do not plagiarize. Thanks in advance!Why is stool examination important in the study of Parasitology? Provide/List 5 specimens in a clinical parasitology laboratory and explain the possible clinical significance of each specimen. Please do not plagiarize.
- Why is it important to grossly check a stool sample in a clinical parasitology laboratory? Please answer in your own words, do not plagiarize. Thanks in advance!What is the importance of blood smear preparation in the diagnosis of bloodborne parasites?Why are polymyxins like Neosporin typically only used topically
- Why is the Baermann-Moraes method suitable for a suspect strongyloidiasis? Why is it considered a geohelminthosis? How could a person show an increase in their parasite load without re-contact with the soil? Please put references in the answerOne example of Group D streptococci that form black colonies on BEA agar is Entrococccus faecalis True FalseWhat makes the Amanita phalloides toxins so harmful that even one cap can kill an adult?
- if a nurses gloves are contaminated with a patients bacterial infection they are? reservoir fomite carrier vector hostWhich of the following could be a method for tetanus transmission.a-Toothbrushb-nailc-sterile equipmentd-all of the aboveWhat is the drug of choice for patient who had S. Aureus culture? Why?