The backbone of a nucleic acid is the nitrogen bases.TrueFalse Which of the following is a section of MRNA produced from the DNA templatebelow?3' ATAGCTA 5'O 5'UAUCGAU 3'O 5'ATAGCTA 3'O 5'AUAGCUA 35'TATCGAT 3'

Nucleic acid is a biomolecule that was composed of a nitrogenous base, a pentose sugar, and a…

Answered: he of a hucleić áčid is the nitrogen…

Science

Biochemistry

he of a hucleić áčid is the nitrogen bases. True

Concepts of Biology

1st Edition

ISBN:9781938168116

Author:Samantha Fowler, Rebecca Roush, James Wise

Publisher:Samantha Fowler, Rebecca Roush, James Wise

Chapter9: Molecular Biology

Section: Chapter Questions

Problem 15CTQ: Transcribe and translate the following DNA sequence (nontemplate strand): 5’-ATGGCCGGTTATTAAGCA-3’

See similar textbooks

Related questions

Q: A cation has a(n) ________ charge.a. neutralb. positivec. alternatingd. negative

A: An atom possessing a net electrical charge is called an ion. It is subclassified as cation and anion…

Q: 2.1 5 (a) Define an acid and a base according to Bronsted-Lowry An acid is: A base is: (b) Explain…

A: Introduction :- Count the hydrogens on each component before and after the reaction to determine if…

Q: Which Latin word is the word acid derived from? What does that Latin word mean? Why is relying only…

A: The acids called acid because it has few chemical properties.

Q: Which acid in each pair has the higher melting point and explain why Arachidonic acid or Archidic…

A: Arachidic acid is also known as eicosanoic acid. It is a saturated fatty acid and does not have…

Q: king of acid

A: Acid is the substance which turns blue litmus to red. Acid contains more H+ ions. Acids acts as…

Q: The PH of a buffer solution should be at ... * Ka value PKa value O 7 14 7.4 ООО

A: A buffer solution is a solution that changes pH slightly on the addition of a small amount of strong…

Q: The test for starch in water is A. silver nitrate. B. iodine. C. barium ions. D.…

A: Starch is a homopolysaccharide molecule that was composed of alpha-D-glucose units in 1-4 and 1-6…

Q: A buffer solution comprises which of the following? O a. Astrong acid in solution Ob. Aweak acid and…

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: Which of these statements is correct with respect to pH? The pH of a solution remains constant with…

A: pH is a measure of the concentration of hydrogen ions in a solution. It is an important quantity…

Q: A pH of 3 is a. basic b. neutral c. acidicd. a buffer

A: Introduction pH plays and important role in determining the concentration of H+ ions in the…

Q: A solution at pH 4 is _____ times as _______ as a solution at pH 7.

A: A solution at pH 4 is _____ times as _______ as a solution at pH 7. A pH of 7 is neutral. A pH less…

Q: The ability of a solution to resist pH changes is called its____________________.

A: The solutions which resist pH changes in a specific range are known as buffers. If small amount of…

Q: The weak acid HA is 2% ionized (dissociated) in a 0.20 M solution. (a) What is Ka for this acid? (b)…

A: The dissociation of a weak acid in water occurs as follows: HA ⇄ H⁺ + A⁻ Ka = [H⁺] [A⁻] / [HA]

Q: The pKa of the HEPES buffer is 7.55. What is its effective buffering range? Any pH below 7.55 Any pH…

A: HEPES means hydroxyethyl-piperazineethane sulfonic acid. Buffers are the solutions that resist the…

Q: Ag+ , K+ , Pb2+, Zn2+ : Classify the Bronsted-Lowry acidity of these cations

A: Brønsted–Lowry theory, known as proton theory of acids and bases. It stated that any compound that…

Q: What are the differences between Benedict's solution and Fehling's solution? ls there a difference…

A: Chemical tests are those that are used to detect the presence of a chemical compound or a chemical…

Q: Why does the addition of acid have so much less of an effect on the pH of blood than it does on the…

A: Blood has a pH of around 7.4 to 7.6. The pH of the water is around 7.0. Blood is composed of red…

Q: 7. 30 grams of acetic acid (60 MM) is added to 120 g sodium acetate (82 MM). The total volume of the…

Q: The commercial hydrogenation of vegetable oil often leads to a trans acid. Explain this statement.

A: Fat hydrogenation is the process of combining fat typically vegetable oils with hydrogen in order to…

Q: Solutions of strong acids and strong bases are alike in that they both taste sour O are corrosive O…

A: Acids and bases that completely ionizes in water are called strong acids and strong bases. Strong…

Q: The pH scale is valid only for water. Why is this so?

A: The scale which is used to measure the acidic nature or basic nature of all aqueous solutions is…

Q: used as a what would be the ratio of conjugate base to weak acid in a pH 7.00 C Choose the on

A: Cysteine is a sulfur containing amino acid. Given, pKa's of cysteine 1.92, 10.70 and 8.37 Amino…

Q: THE LEAST EFFICIENT BUFFER MIXTURE a. 0.001 M HCI & 0.001 M NaCI b. 0.1 M NH4CI & 1M NH4CI c. 1 M…

Q: As pH increases, there is increasingly more H+ than OH-

A: The pH of a solution is the log of hydrogen ion concentration with a negative sign. pH = -log (H+)…

Q: A buffer solution comprises which of the following? O a. Astrong acid in solution O b. Astrong acid…

A: Biomolecules - Biomolecules are the molecules which are present in in living organisms. They can be…

Q: A conjugate acid-base paira. acts as a buffer.b. can combine with H+ in a solution.c. can release H+…

A: A buffer solution is an aqueous solution consisting of a mixture of a weak acid and its conjugate…

Q: A buffer is composed of a weak acid and its _____________ base

A: Buffer is a solution containing an acid and a base, or a salt, that tends to maintain a constant…

Q: pH represents the:

A: Answer - pH stands for potential of hydrogen and it is calculated as negative logarithm of hydrogen…

Q: Estimate the pH of a solution prepared by dissolving 1.0 × 10-10 mole of a strong acid in a liter of…

A: Analyze: We are asked to determine the pH of a solution prepared with a strong electrolytes that…

Q: The acid -base titration curve shown most likely resulted from 12- 10- 8- 6- 2- 01 60 20 Volume of…

A: An arrhenius acid donates a proton (H+), so a polyprotic acid donates protons.. However, a…

Q: A base is added to a 0.050 M solution of MnClz, raising the pH gradually. Calculate the pH of the…

Q: Water forms stronger hydrogen bonds than ammonia. Suggest a reason for this.

A: Hydrogen-bonding is considered as the weakest bond, which is present between the two electronegative…

Q: Purines are characterized by triple hydrogen bonds. The statement is TRUE OR FALSE

A: Nitrogenous bases like purines and pyrimidines are the important molecules in the formation of DNA…

Q: are fragrant carboxylic acid derivatives. O Nitriles O Esters O Amides O Anhydrides O Acid chlorides

A: The derivatives of carboxylic acids are nitrile, acid chloride, acid anhydride, amide, and esters.…

Q: Difference between weak and strong acid

A: An acid is a chemical substance or agents that release hydrogen ions when dissolved in water. The…

Q: Another characteristic of modern buffers such as HEPES is that their pH changes little with changes…

A: Base and acid both interact with each other and form salt and water. They both are used in everyday…

Q: rochloric acid Lemon Apple Banana Water Baking soda Drain cleaner Ammonia 12 3 14 Most acidic Most…

A: A solution having a pH value below than 7 is known as an Acidic Solution whereas a solution whose pH…

Q: barite mineral is included in the formation of

A: Clay soil is soil that is comprised of fine mineral particles and some organic material.

Q: A solution contains 40 g of common salt in 320 of water. Calculate the concentration in terms of…

A: Mass per cent is a way of expressing a concentration or describing the component in a particular…

Q: If the addition of an acid or a base to a solution does not change its pH (or changed minimally),…

A: The question asks to fill up the statement:If the addition of an acid or a base to a solution does…

Q: This atom (group) is removed and converted to an ammonium ion, which ultimately is excreted from the…

A: The organs involved in the human excretory system make it easier to remove nitrogenous waste…

Q: Pure water has a pH of 7, the point at which the concentrations of hydrogen ions and hydroxide ions…

A: pH is defined as the negative log of the hydrogen ion concentration. It ranges from zero to seven.…

Q: ___________ are nitrogen bases with one. They include __________ and ___________.

A: Pyrimidines are nitrogen bases with one cyclic ring. They include Thymine, Cytosine, and Uracil.

Q: Which of the following is TRUE if pH is higher than the pka of the buffer? O [weak acid]…

A: A buffer is a solution that is composed of a weak acid and its conjugate base. The pKa value is the…

Q: The incorporation of inorganic nitrogen into organic molecules is called _____________

A: The higher plants absorb the nitrogen which results in the formation of organic molecules further…

Question

The backbone of a nucleic acid is the nitrogen bases.
True
False

Which of the following is a section of MRNA produced from the DNA template
below?
3' ATAGCTA 5'
O 5'UAUCGAU 3'
O 5'ATAGCTA 3'
O 5'AUAGCUA 3
5'TATCGAT 3'

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Question 1

VIEW

Question 2

VIEW

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.

Similar questions

Transcribe and translate the following DNA sequence (nontemplate strand): 5’-ATGGCCGGTTATTAAGCA-3’
A section of template DNA has the following sequence of nitrogenous bases: 5’-CGATTACTG-3’. Which of the following sequences would be produced as a result of transcription? Group of answer choices CGTUUTCAG CGAUUACUG GCUAAUGAC GCTAATGAC
Provide the complementary strand and the RNA transcription product for the following DNA template segment:5'-AGGGGCCGTTATCGTT-3'
GIVEN THE FOLLOWING DNA SEQUENCES (+) OF THE GENBANK: INDICATE WHICH IS THE TEMPLATE MOLECULE, WHICH IS THE mRNA AND THE POLYPEPTIDE THAT IS FORMED FROM THE SEQUENCE DNA 5' atgagtaaagga 3'
The template strand of DNA is 3’AGGATGCACGTAC5’ The sequence of the mRNA that is made from this DNA is: A) 5’UCCUACGUGCAUG3’ B) 5'AGGATGCACGTAC 3’ C) 3’UCCUACGUGCAUG5’ D) 3’AGGAUGCACGUAC5’ E) 5’AGGAUGCACGUAC3’
does anyone know how to list the RNA sequence transcribed from the DNA template sequence TTACACTTGCTTGAGAGTC.
Which of the following endonuclease removes a length of DNA between two telomere sequences?a) EcoR1b) EcoR2c) BamHId) HindIII
List the sequences of RNA that would be transcribed from the following DNA template sequences. TTACACTTGCTTGAGAGTC ACTTGGGCTATGCTCATTA GGCTGCAATAGCCGTAGAT GGAATACGTCTAGCTAGCA
5’ GGACCTATCAAAATCCTTATGCGCTAGGATAGCTAACGCATCCAC3’ This is the template strand. The +1 transcription start site is bold. Transcribe template DNA to mRNA. Make sure you write mRNA in the 5’ to 3’ direction. This is tricky – don’t assume the polymerase knows right from left. It can only synthesize new DNA in 5’>3’ direction.
RNA polymerase transcribes the following DNA template strand: 5' ACC TTT CCG 3' What is the RNA sequence going to be?
DNA is made of two strands that are antiparallel. If one strand runs from 3’ to 5’ direction the other one will go from 5’ to 3’ direction. During replication or transcription, whatever the process is, it will always follow the 5’ to 3’ direction using the 3’ to 5’ directed strand as the template strand. Therefore, if following is the DNA sequence5’-CCG ATC GCA CAA-3’a) Using this sequence as template after transcription no protein can be translated. Why? I. Presence of start codonII. Absence of start codonIII. Due to mutationb) If you want to start the translation, what change you need in the second codon (from 5’ to 3’ direction)?I. Substitution of C with GII. No changeIII. Deletion of CIV. Both I & III
Transcribe an RNA from the following DNA Template sequence:5’-CCA ATG GCA ATG ATT-3’