The pks of the amino acid Cys are 1.92, 10.70 and 8.37. If Cys was used as abuffer, what would be the ratio of conjugate base to weak acid in a pH 7.00 Cysbuffer? Choose the one closest answer.Be sure to show your work on your scratclr paper. You cannot receive creditwithout showing your work.0.0000083 to 10.000199 to 1O 0.043 to 1O 23.4 to 1

Cysteine is a sulfur containing amino acid. Given, pKa's of cysteine 1.92, 10.70 and 8.37 Amino…

Answered: used as a what would be the ratio of…

Science

Biochemistry

used as a what would be the ratio of conjugate base to weak acid in a pH 7.00 C Choose the on

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Related questions

Q: A base is added to a 0.050 M solution of MnCl2, raising the pH gradually. Calculate the pH of the…

Q: When 50 grams of KCI is dissolved in 100 grams of water at 50 °C, the solution can be correctly…

A: Introduction: The solid substance that can be dissolved into a liquid is referred to as solute. On…

Q: The structure given is

A: Acid is any species, simply an ion or molecule, that can accept electron pair to form a coordinate…

Q: A beaker with 1.40x102 mL of an acetic acid buffer with a pH of 5.000 is sitting on a benchtop. The…

Q: Given below structure is a reducing or non-reducing sugar

A: Carbohydrates are one of the four biomacromolecules. They are also known as polyhydroxy aldehydes…

Q: Assume the energy of hydrogen bonds per base pair solution at 319 K. ratio - 283

A: 9.8.2016 Cresawn BIO 140 The Chemistry of Life I. Ionic Bonds a. So different, that electrons are…

Q: Lipids are soluble in O A. Organic solvents O B. Non-polar solvents O C. Acetone O D. Chloroform E.…

A: Biomolecule, also called a biological molecule, is a substance that is produced by cells and living…

Q: Find the molarity of a solution that is made by dissolving 76.54g NaCl in enough water to make a…

A: Molarity is used to describe the concentration of a solution. It is the number of moles of solute…

Q: An amino acid mixture of phenylalanine, glycine and glutamic acid is to be separated by paper…

A: Paper chromatography is the analytical process by which mixtures of complex compounds such as amino…

Q: You need to prepare an acetate buffer of pH 5.43 from a 0.621 M acetic acid solution and a 2.95 M…

A: At equilibrium 0.40875 - x moles of acid x moles of its conjugate base. Initial moles of CH3COOH…

Q: Draw the structure of the same tripeptide at pH 7.00.

A: The pKa values of amino acid side chains, the pKa of the alpha amino group at the N-terminus and the…

Q: A. Biuret Test Mix 1 mL of sample with 1 mL of 5% NaOH. Add 2 – 3 drops of 1% CuSO4. Question…

A: Biuret test is done to check for the presence for proteins. CuSO4 and NaOH are used as reagents.…

Q: 50 microliters of your original sample to the Bradford reagent. What is the concentration of your…

A: Proteins are made up of amino acids that have been polymerized. As a result, amino acids are…

Q: Ellman's reagent is used to quantify the (one word) content of proteins.

A: Proteins are large biological polymers (macromolecules) made up of monomer units of amino acid…

Q: Basic chemical properties of amino acids with aromatic radicals in proteins. Use a few examples.

A: The aromatic amino acids found in protein are phenylalanine, tyrosine, and tryptophan. Phenylalanine…

Q: For a weak acid with a pKa of 6.0, calculate the ratio of conjugate base to acid at a pH of 5.0

A: The Henderson-Hasselbalch equation helps to describe the derivation of pH as a measure of acidity in…

Q: The OH ] of a solution can be determined from the pOH using the equation OH"]= 10" POH

Q: 3. Phenol red is a pH indicator that turns _________ when conditions are acidic.

A: Acids are the substances that can generate hydrogen ions when dissolved in water and are generally…

Q: 20 mL solution is 2 M NaOH. If 0.5 M HCl is to be added to this solution, calculate the pH of the…

A: pH is the negative logarithm of hydrogen ion, used to measure the acidity and basicity of the…

Q: In X-ray crystąllography, the wavelength of an X-ray is - 1.5 Å. This is useful in determining a…

A: X-ray crystallography is a technique used in the determination of three-dimensional atomic…

Q: Given Raffinose, Briefly explain its expected reaction (based on their structural formula) to the…

A: Raffinose is a trisacharide made by three monosacharide units galactose Glucose and fructose.…

Q: Draw the structure of KID tripeptide and calculate it isoelectric point

A: K stands for Lysine I stands for isoleucine D stands for Aspartic acid

Q: Using octahedral symmetry, match each ligand SALC with its most likely interaction with a meta…

Q: Your friend need to purify a sample left behind by an older graduate student to isolate the…

A: The answer given below in the image

Q: Put these concentrations in decreasing order of magnitude (that is the largest concentration first…

A: Given Values: Acrylamide stock conc. = 30% SDS stock = 10% Final concentration in the gel = 12%…

Q: A solution in which ["OH] = 6.3 × 10-/ M has a higher pH than a solution with a [-OH] = 4.3 x 10-2…

A: Acids are substances that can release an H+ ion. Bases are substances that accept an H+ ion. There…

Q: Describe how you would prepare a 500 ml of 0.35M Glycine pH2.2 from a 5M Glycine solution of pH 7.…

A: Ans- Given Molarity = 5M Desired Molarity= 0.35 M Desired Volume (V2) = 500ml…

Q: Why picric and tannic acid is used for the treatments of burn. Explain this in the concept of…

A: Tannic acid and picric acids are phenolic compounds. These are water-soluble compounds…

Q: A base is added to a 0.050 M solution of MnClz, raising the pH gradually. Calculate the pH of the…

Q: Water forms stronger hydrogen bonds than ammonia. Suggest a reason for this.

A: Hydrogen-bonding is considered as the weakest bond, which is present between the two electronegative…

Q: Glycine hydrochloride (Cl− H3N+CH2COOH) is a diprotic acid that contains a carboxylic acid group and…

A: Glycine hydrochloride is a non essential amino acids and is mainly found in gelatin and silk fibroin…

Q: You are preparing 1 Lt of TAE (Tris Acetate EDTA) gel running buffer from a 50x stock solution. How…

A: In a gel running buffer 1x TAE buffer is used. Given, Final volume = 1 liter Stock solution is 50x…

Q: Given Tagatose, Briefly explain its expected reaction (based on their structural formula) to the…

A: Tagatose is ketohexose i.e. it has 6 carbons and is a ketose sugar.

Q: Make a 100 ml of a 1M stock solution of NaCl (you will need the molecular weight of NaCl).

A: molecular weight of Back is 58.4 Molarity (M) is the amount of a substance in a certain volume of…

Q: Φ and ψ in the Ramachandran plot (below) are: a) Rotational angles around the bond between the…

Q: A 0.10 M solution of the deadly poison hydrogen cyanide, HCN, has a pH of 5.2. Calculate the [H3O+]…

A: The hydronium ion concentration can be found from the pH by the formula [H3O+] = 10-pH or [H3O+]…

Q: Tris NaCl buffer is known as?

A: Tris (with HCl) has a slightly alkaline buffering capacity in the 7–9.2 range. The conjugate acid of…

Q: calculate the molarity of the oxalic acid standard solution.

A: The reaction of oxalic acid with NaOH can be written as: H2C2O4(aq) + 2 NaOH(aq) → Na2C2O4(aq) + 2…

Q: What is the molarity of the following solution: 47g of KCl dissolved in enough water to give 375 mL…

A: Molarity (M) is the amount of a substance in a certain volume of solution and is also known as the…

Q: What inferences can be made from the Benedict’s test of the hydrolysates of the following? Was the…

A: Asked: Inference and if the given sugar was hydrolysed

Q: A 1.0-L 0.010 M buffer with pH 6.50 is given as an assignment to a group of students. Which is the…

A: A weak acid is used to prevent any change in the pH of the solution, regardless of the solute. On…

Q: You need to nake 100mL of a 0.2 molar sucrose (C12H22O11) solution. How much sugar do you need to…

A: Molarity in simple terms can be defined as the amount of any substance present in a certain volume…

Q: Given Ribose, Briefly explain its expected reaction (based on their structural formula) to the…

A: Ribose is a pentose sugar. It is an alose. The structure of ribose is given below: Qualitative…

Q: Polymers of macromolecules are disassembled to monomers by: O a. Van der Waals interaction O b.…

A: A polymer is a large molecule that is made from many small repeating chemicals called monomers.

Q: A certain weak acid, HA, with a K, value of 5.61 x 10-6 is titrated with NAOH. Part A A solution is…

A: pH is defined as negative logarithm of hydronium ion concentration.pH=-log[H3O+]. In a titration, a…

Q: An aqueous solution is 22.0% by mass ethanol, CH3CH2OH, and has a density of 0.966 g/mL. The…

A: Introduction: Molality is the ratio of the number of moles of solute per kilogram of solvent. Its SI…

Q: The end product of protein metabolism is often ammonia, a base. What effect will this have on pH,…

A: Ammonia is the end product of protein metabolism. Ammonia formed as the end product of protein…

Q: An aqueous antifreeze solution is 45.0% ethylene glycol () by mass. The density of the solution is…

A: Hello, thank you for your question. This question is a chemistry question but we are providing you…

Question

The pks of the amino acid Cys are 1.92, 10.70 and 8.37. If Cys was used as a
buffer, what would be the ratio of conjugate base to weak acid in a pH 7.00 Cys
buffer? Choose the one closest answer.
Be sure to show your work on your scratclr paper. You cannot receive credit
without showing your work.
0.0000083 to 1
0.000199 to 1
O 0.043 to 1
O 23.4 to 1

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps with 2 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.

Similar questions

For a weak acid with a pKa of 6.0, calculate the ratio of conjugate base to acid at a pH of 5.0
WHAT ARE THE ADVANTAGES AND DISADVANTAGES OF CARBOHYDRATES IN BIOCHEMISTRY? GIVE AT LEAST 3 FOR EACH AND EXPLAIN. WHAT IS THE PRINCIPLE AND APPLICATION OF BENEDICT'S TEST IN THE TEST FOR REDUCING SUGAR?
Tomato juice has a OH- concentration equal to 1 X 10 -10, what is the pH of this solution?
Can we determine the type of monosaccharide with the Molisch experiment?
Draw the titrimetric profile of tyrosine and calculate its isoelectric pH
What is the Beer-Lambert’s Law? Why is it relevant to the quantitative analysis of proteins?
What is the melting temperature and G/C content of the following primers? a.) 5’ GAAATAATTTTGTTTAACTTTAAG 3’ b.) 5’ GTAACTCAGCTTTCAGGTCG 3’
TE buffer consists of 10 mM of Tris-Cl, pH 7.6 and 1mM of EDTA, pH 8.0. You need to prepare 3L of TE buffer and you have the following stock solutions: 500 mM Tris-Cl and 1 M EDTA. How will you prepare the 3L of TE? Write work clearly
1.2. Using DEAE-cellulose as ion exchange resin, indicate the starting and ending pH for the narrowest experimental pH range used to separate an amino acid mixture consisting of Cys, His and Leu Starting pH: _____ Ending pH: _____
The ionization of p-nitrophenol is shown below (pKa = 7.0): a. Identify the weak acid and conjugate base. b. At pH 7, what are the relative concentrations of ionized and un-ionized p-nitrophenol? c. If enough concentrated hydrochloric acid is added to a solution of p-nitrophenol to lower the pH from 7 to 5, what will happen to the relative concentrations of the ionized and un-ionized forms? d. Ionized p-nitrophenol has a yellow color, while the un-ionized form is colorless. The yellow color can be measured using a spectrophotometer at 400nm. In order to determine the total amount of p-nitrophenol in a solution, would you perform the spectrophotometer reading at an acidic or basic pH? Clearly explain why? e. A solution of p-nitrophenol at pH 7.95 was found to have an A400 of 0.255 . What is the total concentration (in µM) of p-nitrophenol (ionized plus un-ionized) in the solution? The molar extinction coefficient of p-nitrophenol is 18,500 M-1cm-1 and the pKa is 7.
A solution with a density of 0.876 g>mL contains 5.0 g of toluene 1C7H82 and 225 g of benzene. Calculate the molarity of the solution.
Complete the following table by providing the Fischer and Haworth Projections of the given sugars. In the Fischer Projection put an asterisk (*) mark in the chiral centers of the molecule. Sugar Fischer Projection Haworth Projection (Complete) alpha-anomer Haworth Projection (Abbreviated) beta-anomer D-Mannose D-Xylose L-Lyxose