Hello! Explain the attached figure please! thank you!! o Multiple-classpharmaceuticalso Essential medicineso Antibioticso Endocrine disruptorso NSAIDSo Psychiatric drugs, etc.o Fire retardantso Fragranceso Sunscreen componentso Antisepticso PlasticizersPersonal careproductso Insecticideso Bactericideso Herbicideso FungicidesPesticidesXenobioticcompoundsOther industrialIllicitproductsdrugso Hallucinogenic compoundso Stimulating compoundso Inhibitor compoundso Organic wasteso Inorganic wasteso e-wasteo Heavy metalsNuclearPharmaceuticalwastecompounds

The attached figure talks about xenobiotic compounds and it's examples. xenobiotic compounds- these…

Answered: Hello! Explain the attached figure…

Science

Biology

Hello! Explain the attached figure please! thank you

Essentials of Pharmacology for Health Professions

7th Edition

ISBN:9781305441620

Author:WOODROW

Publisher:WOODROW

Chapter24: Reproductive System Drug

Section: Chapter Questions

Problem 10CRQ

See similar textbooks

Related questions

Q: Vhich colorectal cancer screening tests are used in men over the age of 50? O Colonoscopy O All of…

A: Cancer. It is a disorder characterised by unregulated cell multiplication. Any cells, including…

Q: List down the protected areas in REGION 12 (Soccsksargen), PHILIPPINES and the endemic species…

Q: A scientist hypothesizes that dysregulated insulin signaling is responsible for the development of…

A: Metabolic syndrome A cluster of conditions that increase the risk of heart disease, stroke and…

Q: Which suspect is the perpetrator of this crime? Explain the results you see in the DNA gel Why each…

A: From the STR analysis we found that the DNA of CS and DNA of individual C will give the bands in the…

Q: Write down the complementary mRNA sequence for each of the following DNA sequence. A:…

A: If template sequence of the DNA is A.. mRNA is .. AUGGAUCGCGUGUACAUCCACCCGUUUCAA

Q: The concept that traits in parents are mixed together to form an intermediate condition in their…

A: Answer : Option (2) is correct. - blending inheritance.

Q: Using the table below, differentiate the effect of two varying pH levels (as indicated by by the…

A: Enzymes are affected by changes in pH. The most favorable pH value - the point where the enzyme is…

Q: Give the economic and ecological importance of Bamboo (the subfamily Bambusoideae).

A: Bamboos are a diverse group of evergreen perennial flowering plants in the subfamily Bambusoideae of…

Q: Summarize how the virus interacts with the cells in the airway and lungs and is related to disease…

A: ICTV announced severe acute respiratory syndrome coronavirus 2 SARS-CoV-2 as the name of the new…

Q: ATP synthase is a protein that catalyzes the formation of the energy storage molecule adenosine…

A: Given: ATP synthase is the protein that catalyzes the formation of the energy storage molecule…

Q: Which theory of aging states that unstable oxygen molecules tend to steal electrons as they bounce…

A: The unstable oxygen molecules have higher energy and can damage the biomolecules.

Q: design a bacterial/archaeal species, what would be its characteristics (e.g. shape, arrangement,…

A: Bacteria are small unicellular microorganism that lacks any proper cell organization (which means no…

Q: ´A D. E В Coronal Suture [ Choose ] Supraorbital Torus [ Choose ] Mastoid Process [ Choose ] Mental…

A: In vertebrates, the cranium is a bony structure that creates the head. It creates a safe chamber for…

Q: Which of the following are recommendations for dietary fat intake in athletes? Check all that apply.…

A: Option 1 is correct . Athletes should consume 20 to 35 percent of their calories from fat. Option 2…

Q: Please give an example of an experiment that can find out if your protein of interest is over…

A: Expression analysis refers to the techniques, that can detect the the expression of different genes…

Q: Compare and contrast the sensory and motor mechanisms between plants and animals using a Venn…

A: Motor is a muscle, nerve or centre that effects or produces movement. Sensory is light, smell,…

Q: does chain abberation due to translocation mutation result to fertile gametes

A: Translocation is a structural change in the chromosome and includes the exchange of chromatin…

Q: principle of a plant virus that transmits through an animal vector

A: A virus is a small microscopic infectious microbe that is non-living until and unless it finds a…

Q: Does sexual selection have the potential to accelerate speciation, please provide an example..

A: Sexual selection has a reputation as a major cause of speciation, one of the most potent forces…

Q: Explain how each of the following tests for syphilis is best used by describing what each tests for…

A: RPR (VDRL) is test for screening syphilis. RPR stands for Rapid Plasma Reagin and the abbreviation…

Q: When comparing Gastropoda with bivalvia, is the relationship monophyletic, polyphyletic, or…

A: Mollusks are soft-bodied animals and the body is divisible into visceral mass and foot. The visceral…

Q: How can a person reduce their own food waste? O Use clean energy in food production facilities and…

A: Only buy food if you have a limited supply.Don't overcook your food.Refrigeration is a good way to…

Q: Give economic and ecological significance of Wheat species (Triticum).

A: Introduction Wheat is a grass that is commonly farmed for its seed, a cereal grain that is a staple…

Q: How do climate change and extreme weather conditions (i.e. typhoons) affect the water management…

A: Introduction Climate change is already affecting life in Asia. as an example, rising temperatures…

Q: Give the number of cleavage of uvarovite, grosullar, and andradite?

A: Garnet is a mineral group made composed of many closely related minerals. Garnet minerals share…

Q: How does the activity of human p53 get regulated through the interaction of the transactivation…

A: p53 is basically a transcription factor that helps in suppressing the growth of the tumor. This…

Q: Styles raph Lungfishes Amphibians Mammals Tetrapod limbs Lizards and snakes Amnion Crocodiles…

A: A tree like or comb like taxonomic relationship among different group of organisms is called…

Q: Protein secondary structure pricipally arises from A H-bonding of backbone atoms in peptide groups…

Q: The 20th century would witness the new anti-biotic revolution that would save millions of lives.…

A: Antibiotics changed medical practice by significantly decreasing the morbidity and mortality…

Q: Please help Why did we use biodegradable nanoparticles? Please use The worksheet below and don’t…

A: Biodegradable Nanoparticles (BNPs) are basically particles with matter of interest (such as gene…

Q: The proteins work together to cause the release of the transcription factor that is bound by the…

A: Answer is D p53

Q: Please help me with questions 1 & 2 1. In photosynthesis, the carbon in CO2 is ______ to form…

A: Photosynthesis is the physiochemical process.

Q: Why would vaccination be more likely to eradicate a viral disease than a bacterial disease? Why can…

A: The last case of Smallpox happened in 1977. Edward Jenner first introduced vaccine of Small pox.…

Q: ANSWER THE SAME ANSWER ANYMORE. PLEASE INCLUDE REFERENCES I NEED IT. MAKE IT DETAILED IN ONE…

A: Endometrial polyp is abnormal growth after menopause in uterus. But also present unusually in young…

Q: 40 words or fewer. Explain why we would not survive without primary producers, in particular…

A: Introduction :- Primary producers, also known as autotrophs, are organisms that get their energy and…

Q: Illustrate polymerase chain reaction through a detailed process map

A: Since then, PCR has played a critical role in a wide range of biological and medicinal studies.…

Q: Please help Why did we use nanoparticles?

A: Nanoparticles are the techniques which are used in the biotechnology which used to identify the gene…

Q: Which of the following is a correct representation of a segment of DNA? 1. 5'ATTC3' 4. 'ATAG3'…

A: A DNA segment has two strands - coding strand and non coding strand. Coding strand is represented in…

Q: What are nutritional disorders

A: Introduction :- Any nutrient-related disease or condition that causes illness in humans is referred…

Q: Please help me answer questions 79 and 82 79. How do CAM plants minimize photorespiration? A.…

A: 79. CAM stands for Crassulacean Acid Metabolism and it is a mechanism of photosynthesis involving…

Q: Define epigenetic inheritance

A: Epignetic markers in the cell occurs in the form of DNA methylation, histone tail modifications like…

Q: happens when traits become more common in a population because of the reproductive success of…

A: Mechanical isolation is defined as the physical incompatibility between the reproductive organs of…

Q: What is biomass

A: Biomass is defined as the total quantity of plants in a particular area.

Q: the adaptations that Orobanchaceae (plant) has evolved to invade and manipulate the hosts (talk…

Q: Name the type of mutation from the following choices: silent, missense, nonsense, frameshift. The…

A: CGA codes for Arginine. GGA codes for Glycine. Since the protein being coded for is completely…

Q: Observation

A: The monosomies , trisomies and other type of chromosomal abnormalities mainly affects the chromosome…

Q: In most populations, population size remain near the carrying capacity as long as limiting factors…

A: Limiting resources are considered as the carrying capacity for any population.

Q: In a population of 10,000 individuals, where 3600 are MM, 1600 are Mm, and 4800 are mm, what are the…

A: Allelic frequency means the rate of expression of a particular allele at a particular location in a…

Q: Explain how scaffold proteins help the efficiency of the AMP kinase cascade. Why is it important…

A: The scaffold protein plays a key role in providing the platform for the specific…

Q: Match the evidence of evolution with its description: f Comparative Anatomy a. structures that don't…

A: Comparative anatomy - comparin strucrures to show species has shared ancestry. Homologous organ -…

Concept explainers

Dissection

Dissection is the process of cutting up the tissue of a dead or live animal or plant, to do anatomical studies and surgical treatments. The purpose of dissection is to learn more about the overall structure of organs and organ systems and thereby understand the physiology of the organism.

Question

Hello! Explain the attached figure please! thank you!!

o Multiple-class
pharmaceuticals
o Essential medicines
o Antibiotics
o Endocrine disruptors
o NSAIDS
o Psychiatric drugs, etc.
o Fire retardants
o Fragrances
o Sunscreen components
o Antiseptics
o Plasticizers
Personal care
products
o Insecticides
o Bactericides
o Herbicides
o Fungicides
Pesticides
Xenobiotic
compounds
Other industrial
Illicit
products
drugs
o Hallucinogenic compounds
o Stimulating compounds
o Inhibitor compounds
o Organic wastes
o Inorganic wastes
o e-waste
o Heavy metals
Nuclear
Pharmaceutical
waste
compounds

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

introduction

VIEW

examples shown in figure

VIEW

examples shown in figure

VIEW

examples shown in figure

VIEW

Step by step

Solved in 4 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

An individual who has been using a drug for an extendedperiod of time suddenly finds himself unable to securemore of the drug. He acts nervous and irritable and ishyperactive. He seems almost desperate to find more ofthe drug, but experiences no sickness, pain, or other outward physical discomfort. Based on his behavior, whatdrugs might he possibly have been using? Explain youranswer.
Which of the following is not a name (brand name or generic name) for prescription opioids. Diazepam Morphine Oxycodone Vicodin
If a drug rep shows up at a doctor's office without an appointment, demanding to see the docter and the waiting room is full of patients what should I tell the drug rep.
1 L Lactate Ringer Pharmacology, indicating the following (indications, side effects, and classifications) in a narrative way. Morphine Pharmacology, indicating the following (indications, side effects, and classifications) in a narrative way.
All of the following are side effects associated with thionamide use, except:A. Arterial hypertensionB. AgranulocytosisC. NauseaD. ArthralgiaE. Toxic hepatitis
PointsIf you were alive in 1900, you would consider heroin __________.A.to belong to the cocaine family of drugsB.safe and completely legalC.a menace to societyD.a dangerous alternative to morphine
Which of the following peptides acts as the bodys endogenous analgesic? Choices A.Tyr-Glu-Glu-Phe-Leu B.Tyr-Gly—Gly-Phe-Met C.Glu-Cys-Gly D.Gly-Cys-Glu
Why benzodiazepines prefer over barbiturates as a sedative and hypnotics? Please answer at your own words.
Why Benzodiadepines consider as a better or safer sedative-hypnotic compare to Barbiturates? Or Why newer sedative -hypnotic are consider as a better/safer compare to older sedative -hypnotic? Please answer at your own words
Which is true concerning benzodiazepines they are not commonly used they have a narrow therapeutic index they synergise with ethanol they will stimulate GABA receptors
A nurse working in a long-term care facility incorporatesaromatherapy into her practice. For which patient would thisnurse use the herb ginger?a. A patient who has insomniab. A patient who has nauseac. A patient who has dementiad. A patient who has migraine headaches
1. What is the medical science concerned with the use of drugs in the treatment of disease? * a Pharmacotherapeutics b Pharmacology c Pharmacoepidemiology Pharmacognosy d Pharmacogenetics 2 Which of the following is ACCURATE about Reboxetine? * a MAO inhibitor b Noradrenaline reuptake inhibitor c Adrenergic agonist d Cholinergic agonist e Selective serotonin reuptake inhibitor 3 In Graded Dose-Response, which of the following parameters refers to the dose producing 50% of the maximum response? * a Potency b LD50 c Efficacy d Ceiling dose e ED50 4 Which of the following statements best describe a partial agonist? * a Interacts with more than one receptor type b Blocks the effect of the antagonist c Cannot produce the full effect even at high doses d Has low potency but high efficacy. e Has affinity but lacks efficacy 5 Which drug promotes transient muscle fasciculation followed by muscle paralysis that is not reversed by Neostigmine? * a Hyoscyamine b Rocuronium c Succinylcholine d…