Using the table below, differentiate the effect of two varying pH levels (as indicated by by the color) to the amylase enzyme. How does pH level affects the enzymatic reaction (enzyme-substrate complex)? Tube 1 Tube 2 Tube 3 Tube 4 Ingredients Starch Amylase Buffer pH 7 Starch Amylase Buffer pH 2 Maltose Water Buffer pH 7 Starch Water Buffer pH 7 Color (1) (2) Orange Blue e3333
Q: 6. a) What is meant by the term "symbiosis"? [K/U] b) Give an example for each type of symbiosis and…
A: Animals breathe in oxygen and exhale carbon dioxide during the process of respiration. Plants, on…
Q: Two homologous chromosomes in ES cells are depicted below with the portion of your gene of interest…
A: CRISPR/Cas9 creates specific double-stranded breaks at the target locus that trigger DNA repair…
Q: Label feedback loop of body fluid homeostasis: kidney anatomy (stimulus, sensor, response, set…
A: The kidneys filter the blood on a regular basis to maintain the body's fluid and electrolyte…
Q: Discuss the short and long term dangers of alcohol. Discuss both dangers to the individual drinker…
A: Alcohol, drugs may give temporary pleasure but they are not solutions for permanent pleasure.
Q: The name of the person who has autism, is an expert on the condition and has written about how…
A: Science and technology have advanced to the point that we can now determine the origins, signs, and…
Q: In certain regions, monk seals overturn rocks to catch prey underneath. But nearby sharks often…
A: Introduction Ecological interactions:- It is the relationship between two different or the same…
Q: How does temperature and PH affect the activity of enzymes.
A: Introduction - Enzymes are proteins that help a person's body's metabolism, or chemical reactions,…
Q: Cancer is a disease that results in uncontrolled cell division. Cancer cells have lost the ability…
A: Mutations are the changes in the DNA sequence. The mutations can be neutral, beneficial or harmful.…
Q: 5. What happens to the population density in a declining po a. It decreases. b. It increases. c. It…
A: Population density can be calculated by three different methods they are arithmetic, physiological…
Q: Describe how Separase, plays a critical role during meiosis and mitosis.
A: Introduction Mitosis and meiosis are the two kinds of cell division. When people say "cell…
Q: What are the principle and basic concepts of Simple staining
A: The simple staining doesn't give a lot of data about the cell separated from the bacteria'…
Q: Now, solve the following problems involving radiation: 1. Why is 1 mGy of alpha radiation considered…
A: Alpha particles is double ionized helium He++ ion. The beta particles is electron like elements.…
Q: Which of the following signs is most often observed in acute and chronic alcoholism? OA. Barret…
A: Alcohol poisoning is a condition caused by the rapid and excessive consumption of alcoholic…
Q: senescence
A: Definition of Senescence: The process of gradual eradication of functional characteristics in living…
Q: 3. Frank weighs 112 kg and John weighs 56 kg. Both are exposed to 5 may of gamma radiation. Do they…
A: Gamma rays are the highest-energy electromagnetic radiation with the shortest wavelength. The…
Q: Short Answer 1. A. You are crossing bunnies. The haplotype of a female bunny, Poppy, is as shown in…
A: The independent assortment of genes states that the alleles of different genes are assortment…
Q: Explain briefly the mechanism of Magnetic Resonance Imaging (MRI) and how is Ampere's Law applied in…
A:
Q: The classification of living organisms is a job that cannot be done by one individual and can never…
A: classification of organism -Each organism is different from all others to a lesser or greater…
Q: U2, the energy of this reaction is coupled to ne pumping of H+. Drug Y can pick up electrons from…
A: Electron transport chain is the last step of cellular respiration. The first being glycolysis the…
Q: What is the main reason for archiving your phage? so that you could repeat the DNA isolation (for…
A: The answer is to store your phage long term so that anyone who accesses the phage database could…
Q: What are the principle and basic concepts of DIFFERENTIAL staining?
A: The simple dye is used in the technique of simple staining to highlight only the specific structures…
Q: Which of the following things is/are true about this organism? O Phylum Chordata O Agnathan Class…
A: Introduction The given image shows a Sea lamprey. The sea lamprey is a parasitic lamprey native to…
Q: You are working with a yeast that can undergo fermentation or respiration. You take equal aliquots…
A: Introduction - Fermentation in yeasts produces ethanol and carbon dioxide, both of which can be used…
Q: which protein consists mainly of a helixes a. hemoglobin d collagen b cotton e…
A: The structure of proteins is organized at four levels. The primary structure shows the sequence of…
Q: The Bax gene, codes for a cytosolic protein that plays an important role in apoptosis. Growth factor…
A: BAX gene is a pro apoptotic member of the BCL2 gene family. Correct statements are: - BAX gene is a…
Q: You are studying the process of oxidative phosphorylation in the lab. You isolate several…
A: Mitochondria is also known as the powerhouse of the cell.
Q: A worker spends 16 hours per week for 10 weeks in an area with 1.2 WL of radon daughters. a) What is…
A: Radon daughters enter the body with the inhaled air. The alpha particle dose to the lungs depends on…
Q: In corn plants, the allele for purple kernel (P) is dominant over the allele for yellow…
A: Given - Allele for purple kernel - P Allele for yellow kernel - p Allele for smooth kernel - S…
Q: Which of the following images shows a phage with a Siphoviridae morphotype? A) B) C)
A: Siphoviridae viruses are double stranded DNA viruses which belong to order Caudovirales. this family…
Q: You are developing a anti-viral treatment for SARS-CoV-2. You decide to have your product target the…
A: The SARS-CoV-2 virus causes Coronavirus Disease (COVID-19), an infectious disease. The following are…
Q: Short Answer 4. You identify two recessive mutations in fruit flies, one that results in curly wings…
A: The chi square (x2) analysis is perform to compare the observed data with expected data. In…
Q: Decreased osmolarity in the renal interstitium and vasa recta results in - (Mark Two) decreased…
A: The regulation of water concentration in the body is mediated by a hormone called vasoppresin or ADH…
Q: You take a sample of cancerous tissue from Individual II-6 from the prior question. What will the…
A: X- linked inheritance X linked inheritance is a pattern of inheritance when the trait is controlled…
Q: Identify four important factors in achieving efficient heat exchange in milk processin
A: Milk processing refers to the process of collecting milk from cattle, pasteurising, clarifying,…
Q: 2. For an SLR disease trait, in a parental cross where the male is unaffected and female is…
A: The most frequent kind of lupus is systemic lupus erythematosus (SLE). SLE is an autoimmune illness…
Q: septic shock is a life -threateningcondition caused by an overwhelming A inflammatory…
A: C. most suitable answer is.. Failure of blood clotting cascade.
Q: A SNP marker is found linked to the cystic fibrosis gene. Cystic fibrosis is an autosomal recessive…
A: Cystic fibrosis follows autosonal recessive inheritance. This means that both the alleles should be…
Q: Outline the structure and function of the brain, spinal cord, peripheral nerves and the autonomic…
A: Function of Brain:- Central coordinating center of the body. Place of association areas and all…
Q: You are recording from a touch receptor in skin. When you stimulate a spot on the skin, the receptor…
A: Answer :- Option (B) is correct. - Whether the receptor sends its output to the somatosensory cortex…
Q: Who was the first to observe microorganisms with a microscope? Crick Pasteur Koch Van Leeuwenhoek…
A: organism that can only be seen under a microscope Bacteria, protozoa, algae, and fungi are examples…
Q: which one of the following statements is incorrect? a. temporal summation occurs when a single…
A: A neuron is a basic unit that serves as a medium for the transmission of a signal (nerve impulse)…
Q: Describe how hormones and the kidney control blood pressure and pH.
A: Hormones are the chemical messengers in your body. They circulate in your circulation and are…
Q: Duchenne muscular dystrophy is a serious condition caused by a recessive allele of a gene on the…
A: X linked disease Those diseases which are linked to X chromosome of an individual and pass through…
Q: Ascaris lumbricoides, I.s. Illustrate the stages of mitosis, as seen under HPO. Label the stages…
A: Answer :: Cell division:- Cell division happens when a parent cell divides into two or more…
Q: 1. Explain the functioning and regulation of the following operons: lac, trp. 2. Explain the…
A: Every organism have various charcyerstics why may or may not be similiar to each individual. Tgese…
Q: ich of the following urine osmolarities reflects a period of decreased ADH secretion? 301 mOm/L 201…
A: When the body's osmolality rises, the body produces antidiuretic hormone (ADH). This hormone…
Q: Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT
A:
Q: Continuing from the question above. You are able to correctly modify the blood stem cells and return…
A: Sickle cell anemia is majorly due to missense mutation which results in valine substitution in place…
Q: (iii) Based on the double-stranded DNA sequence of terminator, draw the structure of hairpin loop…
A: Hairpin loop structure It is the secondary structure of mRNA where the complementary base pairing…
Q: A loss of function mutation in both alleles of the Bcl2 gene A loss-of-function mutation in both…
A: For the cell to evade apoptotic pathways, they need to get rid of things which kill the cell as is…
Using the table below, differentiate the effect of two varying pH levels (as indicated by by the color) to the amylase enzyme. How does pH level affects the enzymatic reaction (enzyme-substrate complex)?
Tube 1 | Tube 2 | Tube 3 | Tube 4 | |
Ingredients |
Starch |
Starch Amylase Buffer pH 2 |
Maltose Water Buffer pH 7 |
Starch Water Buffer pH 7 |
Color | (1) | (2) | Orange | Blue |
e3333
Step by step
Solved in 2 steps
- Enzyme Triacylglycerol Lipase Rennin Catalase Hexokinase Enzyme Official Name (write N/A if not applicable) Enzyme Official Number (4 digits) Simple or Conjugated Enzyme (specify cofactor if applicable) Type of Reaction Catalyzed Substrate Optimum pH Optimum Temperature Function/s Disease (give 1 and describe briefly)Idris has successfully extracted enzymatic proteins from the fish viscera (intestines and stomach). After homogenization and centrifugation, he managed to pool the crude enzyme extract. He is characterizing the enzymes. Please help Idris by answering the followingquestions:(a). How do I determine the enzyme activity? Please give the unit. (b) How do I get the specific activity of this enzyme? Please give the unit.Use the data from the table below to answer the questions on an ezyme obtained from potato extract. The greater the absorbance value, the more product generated for each chemical reaction Table 1: Summary Data for Enzyme Catalyzed Reaction Product Formation Measured as Absorbance Tube Distilled Water Catechol PTU (Inhibitor) Potato Extract Results (Absorbance) 1 5.5 ml 0.5 ml -- --- 0.02 2 5 ml 0.5 ml --- 0.5 ml 0.68 3 4.5 ml 0.5 ml 0.5 ml 0.5 ml 0.04 4 4.5 ml 0.5 ml 1.0 ml 1.26 5 4.5 ml 1.0 ml 0.5 ml 1.22 a) Explain with respect to enzyme activity why test tube 1 produced very little absorbance: b) Explain with respect to enzyme activity why test tube 3 produced very little absorbance: c) Explain how to tubes 4 and 5 differ with respect to reaction conditions. d) Explain with respect to enzyme activity why tubes 4 and 5 have similar absorbance and why both have…
- Please handraw this graph with all the necessary detailed information: Imagine that I text enzyme rate for four different temperatures: 10 degrees celsius, 20 degrees celsisus, 30 degree celsius, and 40 degree celsius, in separate tubes. The enzyme appears to work faster as temperature increases, but completely ceases activity at 40 degrees celcius. Sketch a graph to show this outcome, but here you will graph product formation (nmoles/mL) vs. time (minutes). The graph should be 4 lines and HANDDRAWN. Include a legend if necessary. You do not need precise quantitivate values, but most show the correct trends on the graph.One way of expressing the rate at which an enzyme can catalyze a reaction is to state its turnover number. The turnover number is the maximum number of substrate molecules that can be acted on by one molecule of enzyme per unit of time. The table gives the turnover number of four representative enzymes. Enzyme Substrate Turnover number (per second) Ribonuclease RNA 100 Fumarase fumarate 800 Lactate dehydrogenase lactate 1000 Urease urea 10,000 How many molecules of urea can one molecule of urease act on in 12.0 min ?Identify the enzyme that carry out the below reaction and denotes the nature of the enzyme? UDP-galactose + N-acetylglucosamine ~ UDP + N-acetyllactosamine
- using the method for experiment below and the table conduct 1 graph of the different factors vs rate of enzyme activity. The experiment began by preparing a hot water bath by boiling water and an ice water bath using ice in a 400 mL beaker. In the control group, 2 mL of 3% H2O2 was placed in a test tube and a pinch of MnO2 was added. The rate of this reaction was assigned as 5, and the production of bubbles in millimeters (mm) was noted. The reaction was considered complete when no more bubbles were produced. Another control group was set up by placing 2 mL of 3% H2O2 in a test tube and adding a pinch of sand, with the rate of reaction assigned as 0. To investigate the difference between plant and animal catalase, 2 mL of H2O2 was added to a test tube and a small piece of fresh liver was added. The rate of reaction between 0-5 was noted, along with the production of bubbles in mm. The same procedure was repeated using a small piece of fresh potato. Next, the effect of…Consider the enzyme pancreatic amylase, which has an optimum pH of 7.0. How is the rate of a pancreatic amylase-catalyzed reaction affected by each of the following changes: (a) lowering the pH from 7 to 4; (b) increasing the pH from 7 to 9; (c) decreasing the temperature from 37 °C to 28 °C; (d) increasing the temperature from 37 °C to 50 °C?Table 2: Effect of pH on Enzyme Activity pH Absorbance 2 0.05 4 0.35 6 0.8 8 0.5 10 0.4 12 0.1 Use the above data table to complete the following questions: a) Plot the data “pH Vs Abs” using “connect the data point type of graph”. Label the graph with dependent and independent variables where they should be. Provide a title for the graph. b) Over what pH range does catechol oxidase catalyze catechol to benoquinone? c) Explain why the graph has a bell-shaped curve.
- Identify the enzymes in Table, whose catalytic effi ciencies are near the diff usion-controlled limit.there are A-D questions to this picture set up. A) What enzyme catalyzes this reaction? B) What is Delta G, please answer in Joules, K=19 C) If concentration of Glucose-1_Phosphate is 48.82 uM at equalibrium, what is the concentration of Glucose-6-phosphate in uM? D) If the reaction is NOT at equalibrium, what is delta G at 25C if the concentration of Glucose-1-phosphate is 15.04 uM and concentration of Glucose -6-phosphate is 1.62 mM? please answer in Joules and in significant figures. *note, 10^3uM in 1 mM Thank you!!⇔ For the enzymes involved in producing ATP at an extremely high rate, please indicate the products andreactants (written as a GENERAL chemical equation) and enzymes involved in the reactions. Enzyme 1: Equation 1: Enzyme 2: Equation 2: Enzyme 3: Equation 3: