Please help me with questions 1 & 2 1. In photosynthesis, the carbon in CO2 is ______ to form glucose. A. Energized B. Reduced C. Broken down D. Oxidized E. Respired 2. The genome of an organism is all of its. A. Proteins B. Genetic material C. RNA D. All answers are correct E. Characteristics

Q: The form of oxygen found toxic to microorganisms is rendered non-toxic by a. Superoxidase which…

A: Superoxide is composed of highly reactive oxygen atoms. It has the ability to reduce metal ions and…

Q: You have a photoreceptor cell in a dish. You are recording its membrane potential while flashing…

A: Answer :- Option (B) is correct. - The cell depolarizes, with brighter light causing more…

Q: which protein interacts with RNA polymerase, in order to allow RNA polymerase to cleave RNA using…

A: SII a protein, interacts with RNA polymerase, in order to allo RNA polymerase (ll mainly) to cleave…

Q: You are working with a yeast that can undergo fermentation or respiration. You take equal aliquots…

A: Introduction - Fermentation in yeasts produces ethanol and carbon dioxide, both of which can be used…

Q: Give a specific example on how to use UV-Vis spectrophotometer in Cosmetic Science.  Provide a…

A: The UV/Vis spectrophotometer is thermo Scientific Multiskan SkyHigh Microplate Spectrophotometer.…

Q: Describe the enzymatic reaction of the protein epidermal growth factor. Include the specific…

A: Epidermal growth factor is a protein, involved in cell cell proliferation and differentiation, by…

Q: Give the economic and ecological importance of Bamboo (the subfamily Bambusoideae).

A: Bamboos are a diverse group of evergreen perennial flowering plants in the subfamily Bambusoideae of…

Q: What is the role of lactic acid? It is converted to pyruvic acid through glycolysis. It is a…

A: Introduction Lactic acid is an integral part of the human body, it is is a chemical byproduct of…

Q: (Select one answer from each dropdown menu:) DNA replication uses as templates to make an Choose…

A: Replication is a process by which two identical copies of DNA are produced. The two new daughter…

Q: With the aid of diagrams, and using specific examples, describe how gene expression is regulated in…

A: Transcription Is the process of formation of mRNA from DNA and this happens in the cytoplasm of the…

Q: of the following is not an example of green infrastructu Pavement Bioswales Bioretention Planter…

A: Lack of greenery has made the life difficult. In order to promote greenery and conserve water, green…

Q: 40 words or fewer. Explain why we would not survive without primary producers, in particular…

A: Introduction :- Primary producers, also known as autotrophs, are organisms that get their energy and…

Q: Given the scenario, compute for the total volume of the culture media solution (milliliter or liter)…

A: We have been given the concentration of the nutrient broth and Agar and we have also been given the…

Q: what is the expected number of individuals of Aa bb Cc genotype if 1000 progeny result from this…

A:

Q: 7. Your tire blew out on the way coming to this exam. What would your hypothesis for the cause of…

A: A hypothesis is built to determine the effect of a change on a particular occurrence. Hence, in this…

Q: Which of the following human cells contains a gene that specifies eye color? Gametes (sperm and egg)…

A: Introduction The fundamental unit of heredity is the gene. DNA, or deoxyribonucleic acid, makes up…

Q: 8. What Is the plcture below illustrating? plart Easier bluebird red-aled huwk 9. Interconnected…

A: As per our company guideline we are supposed to answer only first question or first 3 subparts of…

Q: Ashu did a titer assay with her phage lysate. She started with 100µL of phage lysate (10) and did 7…

A:

Q: Match the following hormones with their actions: ACTH epinephrine testosterone ADH estradiol…

A: INTRODUCTION Answers to question 1-10 is given below.

Q: Did you have an experience when a stranger acted caring and was helping you? What impact did that…

A: Empathy creates a connection that enables us to feel compassion. We can sense the suffering of…

Q: Answer the following questions about this phylogenetic tree. What animal represents the out group in…

A: According to bartleby guidelines, only the first three subparts have been answered. Kindly post the…

Q: ´A D. E В Coronal Suture [ Choose ] Supraorbital Torus [ Choose ] Mastoid Process [ Choose ] Mental…

A: In vertebrates, the cranium is a bony structure that creates the head. It creates a safe chamber for…

Q: ic Variation and Evolution Mastery Quiz ay 2 at 2:40pm Instructions Question 1 1 pts In Mendel's…

A: In monohybrid cross of Mendel's experiments : Dominant = TT Heterozygote = Tt  Recessive = tt

Q: Sex linked 6. traits are those found on the chromosomes determining gender, and show up more often…

A: Multiple allele is a condition and according to that, In a gene there are more than two alternate…

Q: The quail somites transplanted in a conventional order were able to develop normally in the chick…

A: Induction is the process by which the presence of one tissue influences the development of others.…

Q: The following DNA sequences were used to generate a contig from a genome sequencing project.…

A: Sequencing is a method for determining an organism's whole genetic make-up. The sequence obtained…

Q: B D A E 1. The RNA primer is denoted by letter 2. The leading strand is denoted by letter 3. The…

A: The DNA replication involves synthesis of new DNA from the old DNA by semiconservative mode. The DNA…

Q: You are working with a bacterial lysogen and have decided to induce lysis. What needs to happen for…

A: Viruses are an obligate intracellular parasites. Some viruses are temperate phages that have to…

Q: Define toxicology dose and response

A: Toxicology Dose response curve is defined as the response of target host to various doses of toxic…

Q: In the DNA of any individual human, about 300 mutations may differentiate the genome from either…

A: Introduction Gene:- A gene is the basic physical and functional unit of heredity. It is a part of…

Q: What are the two important parts of Meromyosin protein?

A: Introduction - Myosin contains a component called meromyosin (mero meaning "part of"). Myosin and…

Q: You have cloned the protein coding region of the porin gene from a phage into a bacterial cell for a…

A: Generally the phage viruses don't have a transcription or replication machinery they are dependent…

Q: Question 14 During RNA chain elongation gyrase proceeds ahead of the transcription bubble in order…

A:

Q: Shown in the figure, is a portion of the electron transport chain pathway, in which electrons are…

A: The electron transport chain is located in the mitochondria in eukaryotes and in the plasma membrane…

Q: How does we know that trees or plants are transpiring base on your experiment?

A: The physiological process by which water is lost in the form of vapour from the living tissues of…

Q: Compare and contrast the immune system/immune response between plants and animals using a Venn…

A:

Q: Which types of macromolecules (protein, carbohydrate, fat, or nucleic acid?) can be enzymatically…

A: Digestion is accomplished by mechanical and chemical processes. Enzymes aid in chemical digestion.…

Q: design a bacterial/archaeal species, what would be its characteristics (e.g. shape, arrangement,…

A: Bacteria are small unicellular microorganism that lacks any proper cell organization (which means no…

Q: Lungfishes Amphibians Mammals Tetrapod limbs Lizards and snakes Amnion Crocodiles Ostriches Feathers…

A: In biology, evolution refers to the change in a species' features over numerous generations as a…

Q: 5. Pernicious anemia is a disease in which the intestine is unable to absorb vitamin B12, frequently…

A: As already mentioned in the question pernicious anemia is a disease which occurs due to inability of…

Q: 2. Calculate the following: a. you are asked to prepare 10 NA slants and 5 NA stab in big tubes. How…

A: Growth media also known as culture media are used to cultivate microorganisms. These media are a…

Q: what are evidences that indivate plants are measuring the length of the night?

A: Introduction  The physiological response of organisms to the length of night or a dark period is…

Q: Most inherited forms of cancer involve _______________ and these individuals are for the mutation.…

A: Firstly we can examine what each of the terms given represents. 1. Tumor suppressor gene: It is a…

Q: ATP synthase is a protein that catalyzes the formation of the energy storage molecule adenosine…

A: Given: ATP synthase is the protein that catalyzes the formation of the energy storage molecule…

Q: intensity €495 1295 567.5 567.9 1995 s

A: M/z means mass to charge ratio . The first step is involves selecting largest leaks in mass spectrum…

Q: From the early 1700s to the modern day, how did various lines of evidence refine scientists'…

A: Cetacean is classified as a group that comprises whales, and dolphins along with the porpoises.…

Q: Illustrate polymerase chain reaction through a detailed process map

A: Since then, PCR has played a critical role in a wide range of biological and medicinal studies.…

Q: A heart microslide demonstrates cells in the shape of pale chords, which have few myofibrilla,…

A: 2. ANSWER;- Contractile cells, Purkinje's fibers Explain;- Contractile cells conduct impulses and…

Q: Write down the complementary mRNA sequence for each of the following DNA sequence. A:…

A: If template sequence of the DNA is A..   mRNA is .. AUGGAUCGCGUGUACAUCCACCCGUUUCAA

Q: Choose one of the strands and transcribe the strand. Show the steps (with proper label) and do a…

A: DNA is the store house of genetic information. This information is transferred to mRNA through the…

Prokaryotic evolution

The term evolution means the gradual change or a transformation from a simple or primitive state to a complex or advanced state. Prokaryotic evolution is a concept that involves the evolution of the form and function of most primitive organisms (prokaryotes) through several stages and changes to form diverse life as a part of organic evolution.