Q: Enzymes activity is the best at: O Optimal pH O Optimal temperature O Any condition O Optimal pH and…
A: Enzymes are biological catalysts that change the pace of chemical processes. Enzyme activity (the…
Q: I. Individuals diagnosed with autism can have reduced expression of the oxytocin gene due to…
A: The majority of mutations develop when the DNA fails to duplicate correctly. All of these mutations…
Q: When one cell sends a signal and nearby cells receive it, their signaling types is: O Direct O…
A: Introduction The ability of a cell to receive, process, and transmit signals with its environment…
Q: 7.How does oxygen and carbon dioxide enter and leave the lung capilliaries respectively? Read and…
A: During the process of respiration the entry and exit of oxygen and carbon dioxide is facilitated by…
Q: O O When CAMP is formed, it will activate: O Protein Kinase C O Protein Kinase A O G-protein O…
A: Cyclic adenosine monophosphate, also known as cyclic AMP or cAMP, is a small, hydrophilic…
Q: Describe how prokaryotes are ecologically important. Give specific examples.
A:
Q: Enzyme linked receptors: Function directly as enzymes or they are linked to enzymes O Are surface…
A: Enzymes are the biocatalyst that are responsible for enhancing the activation energy. These are…
Q: arasympathethic stimulation of the lungs causes bronchi to dilate bronchioles to dilate bronchi to…
A: The autonomic nervous system is divided into the parasympathetic nervous system and the sympathetic…
Q: different kinds of waste produced in a Nuclear Medicine Department. What are the appropriate…
A: Nuclear Medicine Department The nuclear medicine department is that branch of science and medicine…
Q: how does a light-colored exoskeleton make beetles better adapted to the environment?
A: Introduction Exoskeleton:- It is a rigid or articulated envelope that supports and protects the soft…
Q: Compare the body plan of a lamprey and a shark
A: Sea lamprey have a tendnecy to prey on the large fishes as well as the shark. These both organisms…
Q: genotype (you hy unlisted components are wildtype): repp lacl* lacP+ laco* lacz*/ repPlacls lacP+…
A: * The lac operon consists of structural genes that codes befor proteins and regulatory genes that…
Q: In prokaryotes, after the ribosomes completes a synthesis, one would expect to find a) a new…
A: Prokaryotic organisms don't have well defined nucleus. The nucleoid is found in place of nucleus in…
Q: Explain, at the molecular level, why human genetic diseases often follow a simple Mendelian pattern…
A: Genes are the sets of nucleotides present in a chromosome that encode particular information…
Q: 4. In cattle, polled (absence of horns) is dominant over horned and roan is the result of the…
A: Let us consider, H is the polled allele (hornless) and h is the allele that represents presence of…
Q: 1. The impact of diet on an individual may vary depending on the individual's genetic makeup. II.…
A: "Genes" are the fundamental unit of heredity. They store genetic information in the form of DNA,…
Q: 14. Guanine normally pairs with cytosine. Oxidative damage can result in the modification of guanine…
A: 8-Oxoguanine is one of the most common DNA lesions caused by reactive oxygen species altering…
Q: friend tells you the following story. "My aunt just received a heart transplant. Her doctors warned…
A: * Here a friend tells that his aunt received heart transplant and doctors warned her body might…
Q: A tumor suppressor gene (TSG) codes for a protein that is part of the system that regulates cell…
A: Normal genes that halt cell division or fix DNA errors are known as tumor suppressor genes. Such…
Q: Compare satellites, viroids, prions, and defective interfering particles (DIPs).
A: Subviral agents include satellites, viroids, prions, and defective interfering particles (DIPS).…
Q: Cell determination is due to cytoplasmic effectors that cause the cell to irreversibly commit to…
A: Cytoplasmic determinants are special molecules which play a very important role during oocyte…
Q: The mouse REST gene is under the control of a promoter region which contains alternative promoters.…
A: Ribosomes perform an important function in protein biosynthesis in the cytoplasm. The mRNAs that are…
Q: Explain the significance of step-wise release of energy in respiration
A: * Energy will be released in our body by means of metabolism and it's pathways. * In humans and…
Q: Explain and give insight why the use of a face shield protect us against COVID 19, and now it is no…
A: The face shield is a transparent kind of plastic and can be remolded to produce transparent glass…
Q: The presence and orientation (direction) of integral glycoproteins indicates that the plasma…
A: The plasma membrane is also known as the Cell Membrane. It is a vital component of a cell that…
Q: The membrane structure that eventually evolved into the double nuclear membrane of the eukaryotes…
A: Introduction The nuclear envelope, also known as the nuclear membrane, is a pair of lipid bilayer…
Q: the diploid somatic nucleus of xenopus has 900 copies of rDNA and in the mature oocyte it could…
A: Transcription is a process in which DNA is converted to RNA.
Q: 15.In innate immunity, physical and chemical barriers serve as the human body's first line of…
A:
Q: 17 Refer to the table. Reaction Chemical equation (kcal/mol) 2 glucose → maltose + H₂O +4.0…
A: The chemical reactions take place with the change of energy. The spontaneous reactions release…
Q: 1. The impact of diet on an individual may vary depending on the individual's genetic makeup. II.…
A: Nutrigenomics is the branch of science that investigates the link between nutrition and changes in…
Q: In humans, hemophilia is an X-linked recessive gene and will only be expressed in females if they…
A: Hemophilia is a X linked recessive disorder so which is inherited in homozygous condition. In rare…
Q: Turtles, lizards, and birds belong to one major lineage of amniotes, and_______ belong to another.…
A: Introduction:- Amniotes are vertebrates that grow their embryos in a sac called an amnion. A…
Q: in the fruit fly, genes for rRNA can be replicated more or less often compared to the rest of the…
A: The regulation of the quantities of protein generated from its mRNA is known as translational…
Q: Icefish live in the extremely c They are the only vertebrates bin. They have a large heart a their…
A: A new study has discovered a concerning link between warmer seas, declining sea ice levels, and…
Q: In photosystem II proton coupled electron transfer reactions are thought to be necessary after which…
A: *The enzyme photosystem II catalyzes light driven oxidation of water in oxygenic photosynthesis.…
Q: 1. Identical twins may show dissimilar phenotypes due to changed methylation patterns of the…
A: * monozygotic twins even they are genetically identical there will be some variation in them the…
Q: In guine pigs, rough coat (R) is dominant to smooth coat (r). What is the expected percentage of…
A: ANSWER';- 50% Explain;- A heterozygous guinea pig (Rr) and homozygous passive guinea pig (RR) have a…
Q: AB blood marries a man heterozygous for Type B blood. Their children could have each of these blood…
A: Woman have blood group AB so having alleles IAIB and man is heterozygous for B blood group so allele…
Q: WHAT IS Humoral Immunity
A: Active immunity is the immunity induced in entities by the exposure of antigens. It is mediated by…
Q: Which is NOT true of eukaryotic cells? A) A true nucleus contains the DNA in the form of…
A: All the true statements for the eukaryotes are:- A) A true nucleus contains the DNA in the form of…
Q: what anatomical system of praying mantis and crab would you recommend as a target of attack and why?
A: Mantis is insect contains over 2,400 species in about 460 genera in 33 families.Mantis are found in…
Q: 20. in differential translation, a different transcript may be recovered depending on which TATA box…
A: Translation: The process through which RNA codes for specific proteins is known as translation. It…
Q: Male birds of paradise have evolved to create sophisticated dance routines to attract females. This…
A: Selection is a process that play a huge role in evolution. Those who are better suited to survive…
Q: Are members of a clade similar because they share a common ancestor, or do they belong to the same…
A:
Q: A bacterial cell with the genotype: lacl* lacp+ laco lacz* lacy* is in a low/absent glucose,…
A: Lac operon is an example of gene regulation in prokaryotes. Lac Operon is a group of genes with a…
Q: e the types of gametes the F1’s may be expected to form and the proportion of each. c. What are the…
A: Autotetraploidy is a genetic abnormality defined by the presence of four times the haploid number of…
Q: A) For this DNA fragment "TGAATTCCCGGGTTCCGGGAATTCGCGCGAATT CCCGGTATA", what is its complementary…
A: As per our Guidelines we are not allowed to answer more than three sub parts at a time.
Q: Contrast a bacterial flagellum with a eukaryotic flagellum.
A: Introduction :- Flagella are filamentous protein structures that can be found in bacteria, archaea,…
Q: A plant cell placed in a hypertonic solution will: O remain unchanged. O swell slightly. O undergo…
A: The three types of solutions that cause water to move in and out of the cell are- Hypotonic,…
Q: Prions (a) consist of RNA with no protein coat (b) are misfolded proteins (c) cause several…
A: A prion is described as a type of protein that has the ability to trigger the normal proteins that…
Please answer fast
Step by step
Solved in 2 steps
- What is the mode of replication of the virus? (this can be presented as a diagram with narrative description) What are its differences from HIV?(i) Describe each way viruses may be classified. And Define each of the following parts of a virus, their composition/structure, and explain their role in the viral life cycle: a. Capsid b. Capsomere c. Nucleocapsid d. Envelope e. Spikes (typed format not handwritten) thanksWhat’s the difference between acute, chronic, persistent, and latent virus? Short answer
- (i) Describe each way viruses may be classified. And Define each of the following parts of a virus, their composition/structure, and explain their role in the viral life cycle: a. Capsid b. Capsomere c. Nucleocapsid d. Envelope e. SpikesWhat is the virus transmission, the morphology and the family name of the virus that causes herpes simplex virus 1 and 2?Why did Sabin create an oral vaccine? - Oral vaccine are always more effective than injected vaccines. - He thought it would be easier to take. - It mimics the normal virus entry into the body.
- 14During the multiplication of a bacteriophage in its host cell, the specific viral growth phase characterized by non-detection of the virus is known as a. Burst time b. Inoculation c. Eclipse d. Capsid growthWho discovered Herpes Simplex Virus Types 1 and 2 and where is its habitat?Ch 19 – Viruses and Prions Describe the lysogenic cycle of a virus. What is the difference between the lytic and lysogenic cycle of a virus? What are vaccines? Book: Biology (Campbell) 11 edition Urry. Cain. Wasserman. Minorsky. Reece