How do I answer this? DNA?If a gene were to have the following sequence of nucleotides...What would be the NORMAL complementary strandproduced during replication?What would be a MUTATED strand producedduring replication?AGTCAGTCHow do the cells one even though of its cells the same

Since there are multiple questions in this particular question, I'll answer the first one for you.…

Answered: How do the cells within one organism…

Science

Biology

How do the cells within one organism perform different functions DNA?

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter6: Metabolism

Section: Chapter Questions

Problem 5RQ: DNA replication involves unwinding two strands of parent DNA, copying each strand to synthesize...

See similar textbooks

Related questions

Q: how to integrate single helix and double helix dna

Q: What are 3 ways that DNA transcription is different from DNA replication.

A: DNA replication occurs before a cell can divide. During DNA replication, DNA helicase unwinds the…

Q: Polymerase chain reaction mimics the cells ability to: translate mRNA into protein transcribe dna…

A: Polymerase chain reaction or PCR rapidly replicates specific DNA fragments without cloning in cells.

Q: An original cell replicates its DNA. The cell undergoes mitosis and cell division, and one of the…

A: Answer One of the cells will contain DNA consisting of one strand from the original cell.

Q: Before a cell divides, it duplicates its DNA in a process called molecule unzips into two strands…

A: Since you have posted a question with multiple sub-parts, we will solve the first three sub-parts…

Q: Evaluating: If a DNA strand reads AATGCTCCAGT, what would the complementary strand read: * O…

Q: What would be the sequence that the RNA polymerase synthese from the follwing DNA sequence? 5'…

A: Transcription: The process of formation of RNA from the DNA by action of DNA dependant RNA…

Q: How is DNA synthesis similar in the two types of organisms?

A: There are a few unique definitions for synthesis of DNA: it can allude to DNA replication - DNA…

Q: Do all living things have DNA? Explain your answer.

A: Eukaryotes and Prokaryotes store genetic information in form of DNA and RNA. Some of them having…

Q: Why does DNA replicate?

A: The cell is the basic structural and functional unit of life. It carries out various functions in…

Q: What forms the chemical code within a molecule of DNA? O The arrangement of the sugars and bases O…

A: Option C is correct.

Q: What life experiences can someone havethat might coil or uncoil your DNA?

A: Epigenetics is an study of effects that environment and behavior have on genes.

Q: Why is it important for DNA to be copied before a cell undergoes mitosis

A: Answer: MITOSIS = It is the process of producing two identical daughter cells from the parent cell…

Q: How does DNA replicate itself?

A: The new daughter DNA strands are formed from template strands of DNA by a process called…

Q: How does a DNA molecule produce copies of itself? O replication O expression O translation O…

A: The production of new DNA from old DNA is known as replication process. The DNA replication occurs…

Q: DNA is often referred to as the “blueprint for life.” Why?

A: Introduction :- Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide chains that…

Q: What enzyme initiates DNA replication? a. ligase b. helicase O c. primase d. gyrase

A: Which enzymes initiates the DNA replication? DNA replication is bidirectional and originates at a…

Q: What do DNA and proteins have to do with each other

A: DNA is deoxyribonucleic acid. DNA contains genetic information. Proteins are made up of amino…

Q: How can replication occur at several places along a DNA double helix? (21.3)

A: Replication :- process of formation of replica. where replica of DNA is formed so that the DNA could…

Q: Why must a cell replicate its DNA?

A: DNA is the genetic material present in the cells.

Q: Why does every cell in our body contain DNA?

A: DNA is deoxyribonucleic acid which acts as genetic material in all the organisms. It is located in…

Q: It is known that RNA is a nucleic acid responsible for the synthesis of proteins. However, there is…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: How does DNA replicate?

A: DNA replication is the biological process of creating original DNA molecules in molecular biology.…

Q: Who has circular DNA?

A: DNA is double-stranded molecule that consists of two strands of nucleotides. The bases in one strand…

Q: Table 1: Characteristics of DNA Questions To what maior group of biomolecules does DNA belong? wers…

A: INTRODUCTION DNA Deoxyribonucleic acid is the heriditary material present in humans and other…

Q: the

A: DNA-DNA acts as the genetic material in most of the organisms . DNA stands for the deoxyribonucleic…

Q: What is the role of DNA polymerase in DNA Replication? unwind and unzip the DNA repair errors reads…

A: DNA is the nucleic acids present in the organisms. DNA is the deoxy-ribose nucleic acid in which…

Q: When DNA is "denatured" for sequencing, what is actually happening? The DNA is hybridized to…

A: Introduction Deoxyribonucleic acid is a polymer made of two polynucleotide chains that coil around…

Q: In cells, long pieces of DNA are organized into individual units called Select one: O a.…

A: DNA is a double helix structure that contains all the genetic information of the organism. As the…

Q: Which step of DNA replication occurs BEFORE DNA polymerase extends the new strand of DNA? - a…

A: Deoxyribonucleic acid (DNA) stores the cell’s genetic information and is present in the nucleus of…

Q: Does all DNA have a function? Is all of the DNA in your genome, for example, part of a gene? Explain…

A: Deoxyribonucleic acid is a polymer made of two polynucleotide chains which wrap around one another…

Q: What is your opinion on Synthetic Life Forms/creation of artificial organisms?

A: Synthetic biology is a branch of science that tries to rationally build living organisms, most…

Q: Before a cell divides, it duplicates its DNA in a process called Replication. During this process,…

A: DNA replication can be defined as a biological process by which two identical copies of DNA are…

Q: Where exactly is DNA found in both plant and animal cell.

A: Cell In biology, Cell is the membrane bound intity that contains basic functional, fundamental…

Q: DNA does not participate directly in the synthesis of proteins. What molecule transfers the…

A: RNA molecules transfer the information from DNA to the site of protein synthesis during replication…

Q: Whats is DNA?

A: The cell's chromosomes are housed/resided in the nucleus, which is a membrane-bound/enclosed…

Q: What is the function of DNA ligase? put DNA together are involved in transcription break down DNA O…

A: DNA ligase then enzyme which is used to catalyse and activate the formation of phosphodiester bonds…

Q: How DNA is organized into chromosomes in bacteria ?

A: A chromosome's chromatin is a DNA and protein-based material. The genetic instructions for a cell…

Q: How is the information in a DNA molecule expressed in an organism? O through plasmids through RNA…

A: The information in a DNA molecule expressed in an organism through protein . During transcription…

Q: Why must DNA molecules replicate?

A: The structure of DNA is composed of two strands of polynucleotides wound around each other in a…

Q: Part 2: DNA Us. RNA DNA and RNA are both types of While DNA is HUGE and a double helix RNA is…

A: Nucleic acid acts as genetic material. Nucleic acids consists of nucleotides. Nucleotides consists…

Q: why is DNA replication is important to humans?

A: In DNA replication, a double-stranded DNA molecule is replicated (by a suite of different proteins)…

Q: Besides replicating DNA, what is another function of DNA polymerase? O protein synthesis O…

A: The DNA (deoxyribonucleic acid) is the hereditary unit of an organism. The genes consist of the DNA…

Q: How DNA is organized into genes ?

A: Genes are composed of DNA. DNA plays a major role in the formation of proteins. In humans, genes are…

Q: relationship

A: DNA: deoxyribonucleic acid is a genetic material in living organisms. It is made up of sugar…

Q: how many chromosomes do bacteria have?

A: Chromosomes are thread-like structures located within the nucleus of a cell. They are the physical…

Question

How do I answer this?

DNA?
If a gene were to have the following sequence of nucleotides...
What would be the NORMAL complementary strand
produced during replication?
What would be a MUTATED strand produced
during replication?
AGTC
AGTC
How do the cells one even though of its cells the same

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Quick help Only cell biology Which process is described in the following paragraph? During DNA synthesis, before the enzyme adds the next nucleotide to a growing DNA strand, it checks whether the previously added nucleotide is correctly base-paired to the template strand. If so, the polymerase adds the next nucleotide; if not, the polymerase clips off the mispaired nucleotide and tries again. This is carried out by cleaving the phosphodiester backbone using the enzyme’s 3’-to-5’ exonuclease activity.
True or false ? Reactions in our cells happen in a perfect way, therefore DNA replication is error free
Multiple ? Strands in _______ Form MembraneSpanning “Barrels”.
DNA Replication: 1. Write in the new (complimentary) strands for each of the two halves of the DNA molecule below to show what the two semi-conserved strands would look like. A G T A C C G G G C A A A C T G C A T T G T G I I I I I I I I I I I I I I I I I I I I I I I I I I T C A T G G C C C G T T T G A C G T A A C A C old strand A G T A C C G G G C A A A C T G C A T T G T G new strand: new strand: old strand T C A T G G C C C G T T T G A C G T A A C A C Gene Expression: 2. Use your DNA strand to construct a part of a messenger RNA molecule. DNA A G T A C C G G G C A A A C T G C A T T G T G mRNA:
a. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS LOCK with NO SPACES between the nucleotides - e.g. ATGCCGAG..... TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT complementary strand: b. Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by using the correct reading frame. Write your answers using the three letter abbreviation for each amino acid. polypeptide sequence: does the sense strand DNA sequence have 5’ and 3’ UTR sequences? 5'UTR = 3'UTR =
BIOMOLECULES - MULTIPLE CHOICE - Please answer properly QUESTION : Which of the following processes occurs primarily to form dATP for DNA synthesis?? A. salvaging sing A-PRT B. de novo synthesis beginning with dPRPP C. converting ADP to dADP using thioredoxin D. all of the above
Please ASAP. Thank you. Regarding the double helix of DNA, which of the following is true? a. Guanine pairs up with cytosine with three hydrogen bonds b. Complementary strands of DNA are held together by covalent bonds c. The backbone consists of ribose sugars H-bonded to phosphate groups d. Uracil pairs up with adenine with two hydrogen bonds
Yes or no? No explanation. rna polymerase are recruiting to start transcription but promoters are DNA sequence. Taq polymerase is enzyme and can synthesize dna at 72 degrees. dna reads 5 to 3 and polymerase reads template 3 to 5.
Junk DNA — Not So Useless After All | TIME.com What was the scientist's error in naming noncoding DNA “junk” DNA. Is the amount of DNA an organism has correlated to intelligence or complexity? What are two discovered uses of noncoding DNA (introns)?
True/false? if false, justify briefly The bacterial nucleoid comprises linear nucleic acid molecules associated with proteins that ensure the compaction of nucleic acids.
Central Dogma of Molecular Biology from DNA to RNA to Protein, discussing the principles underlying the transfer of information in a biologic system and its regulation. However, recent research seems to challenge certain aspects of Crick’s Central Dogma. Does the Central Dogma still stand today? If not, can you find an example for a type of information transfer that is not explicitly covered by the Central Dogma (or even violates it)?
Energy that drives the attachment of a nucleotide to the end of a growing strand of DNA comes from _____. a. the nucleotide b. phosphate-group transfers from ATP c. DNA polymerase