How do you compute quantum yield (Φ) and what does the value tell you about the plant?
Q: PEP and 2-PG have similar amounts of potential metabolic energy with respect to decomposition to Pi,…
A: Glycolysis occurs in the cytoplasm of the cell. Glycolysis converts glucose into two molecules of…
Q: 1. Explain the stepwise breakdown of starch. 2. Discuss the role of undigestible carbohydrates in…
A: Starch is a polysaccharide, made up of two units; namely amylose (α 1-4 linkage) and amylopectin (α…
Q: When doing automated sequencing, on the other hand, all 4 dideoxynucleotides are added to the same…
A: The genetic information is encoded in the sequence of DNA that is the genetic material. The Sanger…
Q: The structure shown is an example of a type of macromolecule (carbohydrate, lipid, protein, or…
A: The biological macromolecules that constitute a cell are proteins, nucleic acids, lipids and…
Q: Which of the following is NOT true of a competitive inhibitor? A) Its effects can be overcome by…
A: Competitive inhibitor- It competes with the substrate for the active site of an enzyme, while the…
Q: Hydrates Experiment: Cupric sulfate crystals were examined. Do you see any water in the crystals?
A: INTRODUCTION : Hydrates experiment - Most of the solid chemical compounds will contain some water if…
Q: Which of the following shows the structure of aspartic acid at pH 11? a H₂N. ОН ОН b H₂N ОН с H₂N ОН…
A: Aspartic acid (Asp or D); ionic form is known as aspartate, is an α-amino acid that is used for the…
Q: 6-25 For Umax 57(Kr+S) constant an enzyme that displays Michaelis-Menten kinetics, what is the…
A: For a one-substrate enzyme-catalyzed reaction, the Michaelis-Menton equation shows the quantitative…
Q: 4. Below each item, identify WHAT it is, indicate WHERE in the cell it is used/made (cytoplasm or…
A: Glycolysis is the metabolic pathway that converts glucose into pyruvate. The free energy that is…
Q: The proton-motive force is a measure of the potential energy generated across the mitochondrial…
A: The electron transport chain (ETC) is a chain of electron carriers present in the inner…
Q: In the article the authors reference the canonical forces in protein folding. Describe how these…
A: As per the central dogma of molecular biology, the DNA contain the information needed to synthesize…
Q: what are the molecular descriptors of phosphatidylinositol?
A: Phosphoinositides are the phospholipids comprising a water soluble head group i.e. myoinositol…
Q: At pH 3, the R-group of histidine is_______ and O protonated; neutral O protonated; positively…
A: Histidine (His or H) is an essential amino acids used in the biosynthesis of proteins. It contains…
Q: Which of the following is zwitterion structure of the amino acid alanine? O NH3 NH3 O NH₂ O OH O no…
A: Amino acids are biomolecules that have an amino group (-NH2), a carboxyl group (-COOH) and a side…
Q: Describe the mechanism of feedback inhibition and the role this process plays in controlling enzyme…
A: The process of enzyme inhibition that is induced by the end product of a reaction to prevent the…
Q: 0 I ОН CH2-CH-CH-CH-C-H ОН ОН ОН ОН
A: Chiral carbon is the carbon atom attached to four different substituents. If any carbon atom is…
Q: Which of the following is not a catabolic fate for pyruvate formed in glycolysis? fermentation to…
A: Pyruvate is the end-product of glycolysis. It is ultimately transported into the mitochondria and…
Q: molecule with a hydrophilic end and a hydrophobic end
A: Molecules with a hydrophobic and hydrophilic end are known as amphipathic molecules. Such molecules…
Q: Which coenzyme is NOT paired with its correct dietary precursor? thiamine → thiamine pyrophosphate…
A: Coenzymes are important in the metabolic pathways as they help enzymes in catalysing the reactions.…
Q: Protein folding can be described as an equilbrium between an unfolded state (U) and the folded…
A: Change in Standard Gibbs free energy (∆G0') is the change in Gibbs free energy (∆G) at equilibrium.…
Q: Which amino acid pair constitutes the hydrophobic patch on sickle cell hemoglobin that results in…
A: Sickle cell disease is caused due to inversion of one base pair (A -> T). Due to which, the sixth…
Q: i) Re-arrange with the Michaelis Menten equation so it involves the ratio [S] Show all steps…
A: Michaelis-Menten equation A mathematical model called the Michaelis-Menten equation is used to…
Q: It is being said that our bodies cannot produce lactic acid but rather lactate and it's the…
A: INTRODUCTION : Lactic acid & Lactate - To understand the difference we have to look at their…
Q: Test I. MULTIPLE CHOICE: Read the statement carefully. use CAPITAL letters. 1. It refers to the…
A: Note: Hi! Thank you for the question. We are authorized to answer one question at a time. Since you…
Q: The biexponential equation for a two compartment model drug is C1,t = 50.0e-1.64t + 20.0e-0.147t.…
A: Pharmacokinetics: The study of the kinetics of drugs absorption, distribution, and elimination…
Q: 1. Discuss how the pH and temperature affect the solubility of protein. 2. Explain "salting-in" in…
A: Proteins are large molecules made up of amino acid residues linked via a peptide bond. Amino Acids…
Q: What is the pI, and how is it determined for amino acids that have nonionizable R groups?
A: There are twenty amino acids which are categorized as basic, acidic, aromatic, aliphatic, or sulfur-…
Q: 1. Oxidative phosphorylation and synthesis of ATP in mitochondria: • ways of ATP formation in cells…
A: Since you have asked multiple questions with multiple sub-parts, we will solve the first three…
Q: General ways of metabolism; catabolic, anabolic and amphibolic reactions.
A: The total number of biochemical processes that keep a biological organism's cells functioning…
Q: 1x GGCGAUGGGCAAUAAACCGGGCCAGUAAGC Identify the start codon, and determine the complete amino acid…
A: Translation is the process of synthesis of proteins from mRNA. Proteins are synthesized by adding…
Q: Which one of the following amino acids is phosphorylated during the process of promoter clearance by…
A: In eukaryotes RNA Polymerase II is responsible for the synthesis of mRNA. The largest subunit of Pol…
Q: The function of the Electron Transport Chain (ETC) in eukaryotic cells is to produce a proton…
A: In the electron transport chain (ETC), the electrons pass through four enzyme complexes, that…
Q: Which of the following, found within the interior of cytosolic proteins, is the most dominant…
A: Introduction Protein is the most abundant macromolecule of our body. Protein performs many functions…
Q: A. Given the 7 proteins in the table, will they all be separated properly using isoelectric…
A: Proteins are high molecular weight biomolecules made up amino acid residues linked via a peptide…
Q: Explain IN DETAIL the reactions and processes of alcoholic and lactic acid fermentation. Include…
A: The process of cellular respiration leads to catabolism of pyruvate after the glycolytic pathway.The…
Q: What effect is seen on a Lineweaver-Burke graph when a non-competitive inhibitor is added to an…
A: Introduction: Enzyme kinetics deals with the study of enzyme reaction rates and the condition that…
Q: (pmol) (a-32P) GMP INCORPORATED N 111 (a) (b) (c) 20 5 (min) 2.6 10 The image above shows an…
A: In eukaryotes the RNA Polymerase II is involved in the synthesis of mRNA. The RNA polymerase and…
Q: 1. Write a short note on transcription. What is TFBS? What is the role of RNA polymerase?
A: Since you have asked multiple questions with multiple subparts, we will solve the first question for…
Q: Which factor does NOT represent a barrier that prevents a reaction from taking place? substrate…
A: Reaction is a process by which a set of molecules is transformed to another. Many factors effect the…
Q: Draw his trp arg pro glu met ile | PH = 2 1b) How many possible structures are there for this? 1c)…
A: Peptides are composed of amino acids. Amino acids are biomolecules with an alpha carbon bonded to an…
Q: The transition state of a reaction is O easily isolated using column chromatography. by definition…
A: The completion of a chemical reaction, from the substrate to the product involves the formation of…
Q: Identify the enzyme involved in this reaction from the Krebs cycle. COO CH₂ CH₂ Coo FAD O isocitrate…
A: Cellular respiration is the process how biochemical energy is generated from food. It involves the…
Q: What effect is seen on a Lineweaver-Burke graph when a competitive inhibitor is added to an…
A: Competitive inhibition is an enzyme inhibition process where an inhibitor molecule (similar to the…
Q: Explain the principle involved for Tollen’s test.
A: Tollen's test is used to differentiate between the two carbohydrates with an aldehyde group or…
Q: is lapoamide involved in oxidation reduction..
A: INTRODUCTION : First of all there is no such biochemical name like Lapoamide(its incorrect) The…
Q: Glyceraldehyde-3-phosphate + NAD+ + Pi → 1,3-bisphosphoglycerate + NADH + H+ ∆G0’ =+6.3 kJ…
A: In a general reaction such as: aA + bB ⇌ cC + dD The free energy changes in chemical reactions are…
Q: Which protein structural features are apparent in the protein structure below? Select all that apply…
A: Different bonds contribute to protein folding. These bonds are hydrogen bonds, hydrophobic bonds,…
Q: Draw the following Lipids in: A) Condensed (detailed) Structure, B) its Block Diagram. C)…
A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…
Q: Triose phosphate isomerase In a key reaction of glycolysis, dihydroxyacetone phosphate (DHAP) is…
A: Given Values: ∆G°=7.5 kJ/mol or 7500 J/molT = 37°C or 310 KR = 8.314
Q: a) b) Shown below is a DNA sequence that encodes for a section of a protein. Please write the amino…
A: In our body genetic information is stored in form of DNA. DNA multiples itself by replication. DNA…
How do you compute quantum yield (Φ) and what does the value tell you about the plant?
Step by step
Solved in 2 steps
- Compute for the Number of plants (Np) of the following given numbers.What is the chemical composition of pure cane sugar, equal original and splenda? and explain based on the composition the sweetness of different sugars and artificial sweeteners.Given the following information, how do you caculate for the kg/hectare in the table?
- What are terpenes and terpenoids? Briefly discuss their main functions and importance in plants. Discuss the significance of the following tests and what constituent is being detected: Keller-Kiliani test Froth test Liebermann-Burchard test Capillary Tubes test Kedde testOn biomass, What are the effects of motor oil on the plant height and leaf size of Phaseolus vulgaris?How do antenna chlorophylls differ from reaction center chlorophylls?
- How can the physical properties of chlorophyll be used in measuring primary productivity in ecosystems? Hint: Can chlorophyll’s near infrared reflection be captured by special cameras?If 120 calories are consumed with 5 prunes, how many calories are consumed with 15 prunes? show work with dimensional analaysisHow do day-neutral and intermediate-day photoperiod plants differ in their requirements?