Glyceraldehyde-3-phosphate + NAD+ +  Pi   →    1,3-bisphosphoglycerate + NADH  +  H+ ∆G0’ =+6.3 kJ mol-1 ②       NAD+ +  H+  + 2e-  →   NADH          ∆G0’ = +61.7 kJ mol-1 ③         Glyceraldehyde-3-phosphate + Pi   →   1,3-bisphosphoglycerate +  H+ + 2 e-        ∆G0’ = ??? kJ mol-1 How are equations ② and ③ related to equation ①? b) Calculate the ∆G0’ for the formation of 1,3-bisphosphoglycerate from glyceraldehyde-3-phosphate and inorganic phosphate (reaction ③ above) c) Why is reaction ③ coupled with the reaction ② when reaction ② is so unfavorable, i.e., what is the chemical role of the NAD+?

Q: Which pathways use substrate-level phosphorylation and which use oxidative phosphorylation?

A: Substrate-level phosphorylation is a metabolic process that involves the direct transfer of a…

Q: Studies of a specific enzyme activity showed that the time the enzyme activity before complete…

A: An organic substance called an enzyme acts as a catalyst for a biological reaction. Each cell in the…

Q: In an Absorptive (fed) state Which predominates? Anabolic or catabolic processes? Which ones…

A: Metabolic pathways are a series of process which includes chemical reactions occurring in a cell.…

Q: Bacteria and other prokaryotic cells have the capacity to get more ATP/glucose oxidized than…

A: “Since you have asked multiple question, we will solve the first question for you. If you want any…

Q: Tube 1: Add 1 mL 5% Trypsin Tube 2: Add 1 mL 5% Trypsin and 2 mL of 0.5% Na2CO3 Solution Tube 3: Add…

A: Trypsin is a proteolytic enzyme that cleaves the peptide bonds in protein and releases individual…

Q: a) What is the Kd you measure for this interaction?

A: INTRODUCTION :   Actin - Actin is a family of globular multi-functional proteins which form…

Q: Select all of the examples of potential energy in the human body below. There may be more than one…

A: INTRODUCTION : Potential energy - It is a type of stored energy which depends upon the relative…

Q: QUESTION: For each enzyme identify the transition-state inhibitor analog by drawing a circle around…

A: Whenever a reaction takes place there are reactants and they form products but in between, during…

Q: Question 24 of 25 Given the following reaction below, what amino acid is involved and what is the…

A:

Q: molecule with a hydrophilic end and a hydrophobic end

A: Molecules with a hydrophobic and hydrophilic end are known as amphipathic molecules. Such molecules…

Q: Which sequencing project(s) would be done better using a next generation method (like Illumina)…

A: Sanger sequencing method - it is also known as chain termination method of gene sequencing. This…

Q: Gluconeogenesis occurs in muscle using the enzyme glucose-6-phosphatase. True False

A: The term "gluconeogenesis" describes a collection of metabolic processes that take place in the…

Q: d) Cleavage by trypsin followed by gel-filtration chromatography gives the expected 6 products,…

A: Since you have posted a question with multiple sub-parts, we will solve the first three sub-parts…

Q: The mitochondrial matrix is home for the following: I. ribosomes II. circular DNA III. Kreb's…

A: Mitochondria is a membrane bound organelle which is also known as power house of the cell as it is…

Q: Which carbohydrate test can you use to distinguish a monosaccharide from a disaccharide? hexoses…

A: A carbohydrate is a biomolecule which consists of carbon, hydrogen and oxygen atoms. The hydrogen…

Q: 1. What color change do you observe in Part B of the experiment? In which of the test tubes did…

A: Proteins are made up of amino acid residues linked via a peptide bond. A peptide bond between two…

Q: The main stages of catabolism of biomolecules: proteins, carbohydrates and lipids.

A: Catabolism is the degradative pathway. It deals with the breakdown of complex molecules into simpler…

Q: What are the roles of the other enzymes involved in replication and why they're necessary ?

A: Before cells divide, DNA replication must occur. DNA replication is the complete, faithful copying…

Q: Draw his trp arg pro glu met ile | PH = 2 1b) How many possible structures are there for this? 1c)…

A: Peptides are composed of amino acids. Amino acids are biomolecules with an alpha carbon bonded to an…

Q: a)   Draw    the    A-T    and    G-C    base    pairs.                 - Label    the    bases…

A: DNA are polymers of nucleotides. A nucleotide consists of a nitrogenous base(A, T, G, C) attached to…

Q: A biosynthetic pathway for the synthesis of two molecules, E or H, from molecule A is shown below.…

A: Enzymes can e reversibly inhibited in presence of competitive and non-competitive inhibitors. Such…

Q: Bacteria and other prokaryotic cells have the capacity to get more ATP/glucose oxidized than…

A: The prokaryotic cell is simple, not complex as the eukaryotic cell. In eukaryotic cells, the site of…

Q: The figure below illustrates what reactions of amino acids? coo &C=0 CH₂ CH₂ 0=( 00 + NHⓇ NAD(P)H+H…

A: The amino group, carboxyl groups, and side chains of amino acids all play a role in how amino acids…

Q: What does bleach do to hair

A: Melanin, the pigment that also affects the colour of your skin, also determines the colour of your…

Q: dideoxy sequencing

A: Identifying the precise order of nucleotides, or bases, in a DNA molecule is done using a standard…

Q: 1x GGCGAUGGGCAAUAAACCGGGCCAGUAAGC Identify the start codon, and determine the complete amino acid…

A: Translation is the process of synthesis of proteins from mRNA. Proteins are synthesized by adding…

Q: What effect is seen on a Lineweaver-Burke graph when a competitive inhibitor is added to an…

A: Competitive inhibition is an enzyme inhibition process where an inhibitor molecule (similar to the…

Q: 1.0 E oxygen saturation (Y) 0.6 0.4 0.2 0.0 20 40 60 blood pO₂ (torr) 80 100 120 for this picture…

A: Hemoglobin carries oxygen from the lungs to the tissues and CO2 from the tissues to the lungs. When…

Q: Starch 1/2 English Muffin Fruit1 medium orange Milk 1 cup low-fat milk - Starch 1/2 c. Corn Protein-…

A: INTRODUCTION : Carbohydrates - Carbohydrates, or carbs(short name), are sugar molecules. Along with…

Q: F.28.   How will phosphorylation of serine change the pKa of Arg, increase, decrease, or no change

A: Serine is a polar but uncharged residue. Arginine is a basic residue due to the presence of an amine…

Q: Discuss how to determine the elements of proteins and its reactions.

A: Proteins are the most abundant biomacromolecule of life. Proteins are primarily polypeptide…

Q: What is the property/characteristics of DNA that makes it insoluble to ethanol/isopropyl alcohol?

A: The mechanical separation of the nuclear contents from the remainder of the cell, accomplished by…

Q: Would you expect the structure of a competitive inhibitor of a given enzyme to be similar to that of…

A: Enzyme inhibition is a process by which the activity of an enzyme is altered. Inhibitors are…

Q: Process: State (at right)

A: The cell membrane is composed of a phospholipid bilayer. The proteins embedded in the membrane (…

Q: Which statements best describe serotonin? Select the correct response(s): It is essential for…

A: Serotonin is a neuro transmitter that transmit the messages from one neuron to other neuron. It is…

Q: What effect is seen on a Lineweaver-Burke graph when a non-competitive inhibitor is added to an…

A: Introduction: Enzyme kinetics deals with the study of enzyme reaction rates and the condition that…

Q: Lipids Function in Cell Signaling Q5.2: The lipids 7-dehydrocholesterol and arachidonate are…

A: Cell signalling is the process in which the cell responds to certain molecules called signalling…

Q: 1. State if true or false a. GLUT5 transporter carries fructose from the intestinal lumen into the…

A: GLUT5 Transporter : GLUT5 is a fructose transporter found & expressed on the apical border of…

Q: 1. Which types of RNA are transcribed by each RNA polymerase enzyme in eukaryotic cells?

A: Transcription is the synthesis of RNA from DNA that is the process of copying the information of a…

Q: Chemistry When the steady-state concentration of a drug on one side of the membrane is 5 micromolar…

A: According to Fick's first law, dC/dt= K(C1-C2)/h

Q: In biochemistry, what is definition of buffer , which amino acid can act as buffer? what is buffer…

A: The functioning of many molecules such as proteins, nucleic acids etc. depends on pH. The pH in…

Q: In the peptide, SWEETLY, bond via its side chain. (Give the full name of the amino acids) can still…

A: Recall that: for a given peptide amino acid sequences are written with N-terminal amino acid on the…

Q: Mnemonic about the UREA CYCLE that is not from the internet. Thank you.

A: Urea cycle is also known as the Ornithine cycle. In urea cycle urea is produced from ammonia. Urea…

Q: What is the free energy for transport of glucose from outside the cell to inside the cell 37°C when…

A: When an ion/molecule/solute moves up or down a concentration gradient, there is a change in free…

Q: There are some cells in our bodies (stem cells) that are able to form new structures even in adults.…

A: Stem cells are undifferentiated cells In our body that can turn into any specific cells, as per the…

Q: What is most correct about the following inhibition? Penicillin

A: The antibiotic penicillin irreversibly binds to and inhibits the activity of the transpeptidase…

Q: A. STARCH TUBE A B C HYDROLYSIS OF CARBOHYDRATES Treatment HCI, heat H₂O, heat RT, H₂O Benedict's…

A: Starch is a polysaccharide and sucrose is a disaccharide. Starch is also known as plant storage…

Q: The side chain of asparagine contains: OA) a hydroxyl group OB) an amine group OC) a carboxyl group…

A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…

Q: Whether done manually or automated, DNA sequencing gels are always made of polyacrylamide rather…

A: Sequencing DNA entails finding the order of the four chemical building components known as "bases"…

Q: How many of the following statements are true? Allosteric enzymes display sigmoidal kinetics for…

A: Allosteric enzymes are enzymes that possess additional binding sites known as allosteric sites.…