How is the chemiosmotic potential generated?
Q: Enumerate foods from margaret's diet recall that fir these criteria. how do high carbohydrate diet…
A: Glucose is a monosaccharide and it is a simple sugar that is the most important source of energy…
Q: 4. Show exactly which peptide bonds you would expect trypsin to cleave if you set a digest with the…
A: Enzymes are protein molecules that increase the rate of biochemical reactions. Trypsin is an enzyme…
Q: A. Write the structure of the following peptide at pH 5.0 and calculate its net charge at this pH.…
A: Hi. Thank you for the question. As per the honor code, We'll answer the first question since the…
Q: What are the main functional groups present in carbohydrates? Illustrate and explain.
A:
Q: 2. The two diagrams to the right il- lustrate plots of steady-state ki- netic studies to…
A: Phosphofructokinase adds a phosphoryl group from ATP to Fructose 6 phosphate (F6P) to yield Fructose…
Q: 8. A paticnt sullering from infectious polyarthritis, has been reeciving prednisone for a long time…
A: Prednisone is a kind of glucocorticoid. It is a prodrug, which means the liver converts it to…
Q: PDB code 7BSJ Questions Q1 - What is the name of the protein Q2 - What does the protein do? Q3…
A: As you asked multiple sub part questions, we are supposed to answer only first 3 subparts for you.…
Q: iscuss the importance of biosafety in modern biotechnolog
A: Introduction: Biotechnology is the use of living systems and organisms to produce useful products or…
Q: Sugar is an organic molecule. Most organic molecules are non-polar compounds making them insoluble…
A: A polar molecule is a molecule containing polar bonds having non-zero dipole moments.
Q: In the Krebs Cycle (Citric Acid Cycle), A 4-carbon compound with a 2-carbon unit to yield a 6-carbon…
A: Kreb cycle/ tricarboxylic acid cycle/ citric acid cylce - occur in matrix of mitochondria.
Q: The hydrolysis of a substrate, S, by an enzyme has been studied in the lab. The following initial…
A: Consider the reaction where a substrate 'S' is converted to its product 'P' by an enzyme. The rate…
Q: Search and explain the Watson and Crick model of DNA.
A: Watson and Crick first described the structure of the DNA double helix using X-ray diffraction data…
Q: (a) In what important ways do the α helix and β sheet structures differ? (b) How are they similar?
A: α helix and β sheet structures are the forms of the secondary shape of the protein. They each are…
Q: Glycolysis is an energy-generating pathway. How much of each of the following is produced when…
A: Glycolysis is the process in which one mole of glucose is oxidized to two moles of pyruvate. It…
Q: depletion of NAD+
A: Nicotinamide adenine dinucleotide ( NAD) is a coenzyme central to metabolism. It is found in all…
Q: b) Consider the following experimental results: Total hydrolysis of a nonapeptide gave:…
A: The linear sequence of amino acids within a protein is considered the primary structure of the…
Q: 7. Calculate the standard reduction potential and the standard free-energy change for each of the…
A: The Value of Standard reduction potential and the change in it's Gibb's free energy can determine…
Q: Given the following pKa data for the individual amino acids, estimate the pI for the tripeptide…
A: In the given data pKa of amino acids Thr-Asp-Arg is: Thr-? Asp-3.86 Arg-12.48 N-terminal group-…
Q: Which of the following describes the correct order of energy conversions necessary to form…
A: Bioenergy is described as one of the most crucial resources that are available in order to meet the…
Q: In a different instance of (d) two intants suspected to have a defi- ciency of the PDH complex…
A: During cellular respiration, respiratory substrates like glucose may undergo complete or…
Q: _____ 1. is the classification of enzyme where carbonic anhydrase belong ______ 2. is the name of…
A: The reaction catalyzed by carbonic anhydrase is given below. H2O + CO2⇌ H2CO3 ⇌ HCO3- + H+. The…
Q: Biochemistry Question Quantitative Comparison Questions 2) A: Phospholipase C, as the Effector in an…
A: Effector molecules are small molecules which regulates the activity of other macromolecules. Thus,…
Q: SCIENTIFIC PAPER INTRODUCTION ONLY- Titrimetric analysis of amino acids.
A: Amino acids are compounds containing carbon, hydrogen, oxygen, and nitrogen. They are composed of…
Q: A) Draw the structure and give the name of a nucleotide made of G + ribose. B) Write the…
A: Ribonucleic acid (RNA) is a polymer of ribonucleotides that participate in diverse biological roles…
Q: Fibrous proteins, globular proteins, and conjugated proteins are the three (3) primary kinds of…
A: Proteins which are most essential part of diet they are building block of body . Protein named by…
Q: Which of the following is the complementary strand of a DNA strand made up of 32% cytosine? A.…
A: Two strands of DNA are complementary to each other , if we know the sequence of one strand, we could…
Q: Categorize the electron carrier by the number of hydrogens that it can transfer in a single…
A: In the process of electron transport, one or more molecules accept electrons from another and donate…
Q: FOV measured at 100x total magnification is 400 micrometers. What is the FOV at 40X total…
A: Formula to find the unknown field of view if the field of view of the scanning value: Total…
Q: Please answer post lab question and give a conclusion about the experiment
A: Browning of potatoes is caused by the polyphenol oxidase enzyme. In the presence of oxygen, the…
Q: Is there a significance in studying the gene structure? Why or why not?
A: Gene is basic heridity unit organisms from which parental characteristics transfer to their childs…
Q: In the absence of oxygen, what would happen to a cell that performs aerobic cellular respiration? O…
A: There are two type of cellular respiration.One is aerobic cellular respiration and other is…
Q: A) What is the difference between a nucleoside and a nucleotide? B) Give any two differences between…
A: DNA as well as RNA are two crucial building blocks of life. The human cells also comprises of RNA…
Q: What does NOT describe a starch?
A: Starch is a polysaccharide that is produced by most of green plants for the purpose of storage of…
Q: 6. Gluconeogenesis generates ________. Select one: A. 2 ATP and 2 NADH B. 1 ATP and 1 NADH C. 1…
A: Gluconeogenesis is a metabolic pathway that results in the generation of glucose from certain…
Q: b) what is the possible cause of this discase?
A: A tiny tumour in the pancreas that produces too much insulin is known as an insulinoma. The growth…
Q: What type of glycosidic bond does the shown disaccharide have? HỌ CH,OH O CH,OHO Но. OH Но. OH
A: The above given disaccharide represents the structure of lactose. Lactose is made up of one molecule…
Q: Acidosis is a human body disorder caused by too much acid in the stomach. If a patient was tested…
A: Acidosis is a condition in which the body's fluids contain an abnormally high level of acid. It is…
Q: Which of the two carbon sources, glucose or acetate, is more advantageous for the cultivation of…
A: E.coli - Escherichia coli, it requires a carbon source to grow to serve as substrate for the…
Q: What aeration condition (presence or absence of O2) favors cell growth? What is the metabolic…
A: Aeration means the presence of oxygen and anaerobic condition means the absence of oxygen. The…
Q: 16. Within the chloroplast, grana are ____. Select one: A. stacks of enfolded thylakoid membrane…
A: A chloroplast is a plastid, which is a source of plant cell organelle. Plastids aid in the storage…
Q: Given the following results from qualitative tests performed on a sample, answer the succeeding…
A: Molisch's Test : This is the common biochemical test that performed to determine the presence of…
Q: What are two important compounds that lie at crossroads of major metabolic pathways? Select both…
A: Metabolic pathway engineering in microbial hosts for heterologous biosynthesis of commodity…
Q: Coenzyme A (CoA-SH) plays an important role in the Pyruvate Dehydrogenase Complex reactio Which is…
A: The pyruvate dehydrogenase complex is a mitochondrial multienzyme complex that catalyzes the…
Q: α-D-galactose from β-D-glucose can be differentiated using which method of analysis? A.…
A: During methylation, a methyl group gets added to every free hydroxyl (-OH) group in the sugar. This…
Q: Describe the whole process and the principle behind DNA extraction.
A: Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide chains that coil around each…
Q: Recombinant protein is produced by a genetically engineered strain of Escherichia coli during cell…
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: A) For this DNA fragment "TGAATTCCCGGGTTCCGGGAATTCGCGCGAATTCCCGGTATA", what is its complementary…
A: Deoxyribonucleic acid (DNA) is a nucleic acid that carries genetic information from parent to…
Q: opinion should be the definite characteristic
A: Life of any organism can be beneficial or harmful depends upon the nature of an organism.
Q: CH2OH NONE H3C-C-H Isotope tracing. Indicate where the OH HO label would appear in the products. If…
A: Isotope tracing is a technique used to track each carbon atom in the carbon skeleton of a molecules…
Q: Do "Enzymatic Browning reaction is intensified with the presence of oxygen?.
A: Introduction Enzymatic browning is a chemical process that we can see in fruits, vegetables etc. .…
14
Step by step
Solved in 2 steps with 1 images
