How many pairs of chromosomes do human beings have, specify the types of chromosomcs also?

Q: S-phase arrest in response to glutamine deprivation in KRas-driven cancer cells can be reversed by…

A: The shortage of deoxynucleotides required for DNA synthesis causes KRas-driven cancerous cells to…

Q: Which of the following traits would you expect to be under weakest selection? Explain your answer.…

A: Natural selection can be defined as sum of natural forces that causes differntial reproduction and…

Q: What is a TED talk? TED stands for "Technology Entertainment

A: TED is a global community, welcoming people from every discipline and culture who seek a deeper…

Q: To explain: The way in which the plants with nodules for nitrogen-fixing bacteria might…

A: Answer--- Nitrogen fixing bacteria are organisms that are able to convert atmospheric nitrogen into…

Q: Figure 1.1 50 Passengers | Crew 40 • Half-day "Cruise cancelled 20 10 10 11 12 13 14 15 16 17 17* 18…

A: INTRODUCTION Salmonella Heidelberg (S. Heidelberg) is a bacterium that can cause severe illness in…

Q: Discuss the principles and applications of Matrix-Assisted Laser Desorption/Ionization…

A: Technology is utilized in science, while science is used in technology. Both are vital to our…

Q: f your 16x concentrated stock solution contains 20g of Nacl per liter, how much Nacl would one liter…

A: Given:- Concentration of stock solution= 16X NaCl required per litre= 20g NaCl required for 1 litre…

Q: How would you determine the sugar-binding specificity of any isolated lectin?

A: .Lectins are the specialised proteins that may bind to a specific carbohydrates present on the…

Q: To examine: Whether the statement "protein tyrosine phosphatases display exquisite specificity for…

A: Introduction Proteins are complex biomolecules and macromolecules that are made up of one or more…

Q: 2. A nursing mother who has an alcoholic drink secretes alcohol into her milk for two to three hours…

A: Alchohol consumption leads to decrease in hormone production.

Q: Please you explain why the answer is true or false for this question.

A: In biology, evolution is the process of a species' features changing over numerous generations by…

Q: A community-based intervention program for hypertension was undertaken in two communities to compare…

A: Given: Hypertension is a prominent risk factor that poses global burden of diseases. It is most…

Q: Based on your understanding of skeletal muscle fiber physiology, which of the following processes is…

A: ATP is the adenine tri phosphate and is the instant source of energy .It is used in many of the…

Q: Indirect bilirubin water insoluble * True O False The ALP are a group of enzymes that hydrolyse in…

A: Bilirubin is found in 2 states ; Direct and Indirect bilirubin. Indirect bilirubin is not conjugated…

Q: MECHANISMS EXAMPLES 1. 1. Geographical Isolation 3. 1. 2. 2. Temporal/Seasonal Isolation 1. 2. 3.…

A: Temporal isolation is when species that could interbreed do not because the different species breed…

Q: 7. How could genetic engineering be of use to humans? Describe at least 2 different uses.

A: Science is humanity's greatest blessing. It has altered human existence; nothing finer could have…

Q: If a phage is undergoing lytic growth, which protein is bound to the operator region? O Both Lambda…

A: INTRODUCTION Lytic stage of phage This is the reproductive stage of bacteriophage  it include 6…

Q: escribe the behavior and neural mechanisms involved luring cricket communication used for…

A: Crickets are nocturnal, so they chirp at night. Male chirp to attract the female for mating.       “…

Q: Whale 100,000 calories 200 kilocalories (kcal) Krill 1,000,000 calories 80 kcal Cellular respiration…

A: The plants and animals produce the organic material which is renewable and it is known as the living…

Q: Explain the process of seed development in a typical angiosperm plant. 2. Describe the two -stage…

A: Angiosperms are flower-bearing plants and are the most diverse group of terrestrial plants. The…

Q: Mike is a 34-year old male who reports to the ER after a motorcycle accident. MRI results show that…

A: In a person that has transected spinal cord injury between T1 and L1, it would have paraplegia.

Q: A condition wherein the presence of a certain allele causes death of the organism. O lethal genes O…

A: a  condition wherein the presence of a certain allele causes death of the organism is called lethal…

Q: 4. In owl, barring (B) is sex-linked and dominant, the recessive allele (b) producing solid black…

A: In owl , there are two types of traits . I ) In case of first trait , Barring is dominant and is…

Q: lain the life cycle (reproduction & development) of ants.

A: Ants are social insects with a social system that divides tasks between the queen and worker ants.…

Q: Kernel color in wheat is controlled by 2 pairs of genes (AABB). Determine the color of each…

A: The inheritance of kernel color in wheat is controlled by two genes. These are A and B genes.

Q: Some substitution mutation result in a malfunctioning protein but others do not. Why is this? 

A: A mutation is a change that occurs while copying or trying to replicate DNA molecules, resulting in…

Q: Helen is a 62 yo smoker. Her physician has dignified her as having emphysema that has caused her to…

A: Given: Blood pH=7.40 To explain: To explain about pH level of a person and its effects

Q: Apopulation is expenencing only selection Alele A1 is favored by selection and starts at a frequency…

A: ANSWER;- 4th and 5th Options are the Correct Answer. Explain;- The Phenomenon Like Natural…

Q: For billions of years, the only bright objects in the night sky were stars or the moon. Night-flying…

A: Moths are nocturnal organisms. They are active during the night to escape from predators. They use…

Q: in certain fish the mating of black-scaled (B) with white a white-scaled (W)  will create offspring…

A: Introduction :- Fish are aquatic vertebrate animals having gills but no digits on their limbs, such…

Q: Create a table comprising example and features from Domain to common name. Create 1 table for each…

A: Taxonomy is the branch of science that deals with the name, description, and classification of all…

Q: 8. Which of the following statements about oxytocin is correct? A. Dilation of cervix and baby…

A: Oxytocin is a hormone delivered by the pituitary organ that causes expanded expansion of the uterus…

Q: The red and white pulp of the spleen is so named A to reflect the staining pattern of tissues…

A: Introduction The spleen is a fist-sized organ located close to stomach and behind the left ribs in…

Q: abel the muscles on the dorsal and ventral sides of the frog. 1 2 10 3 11 12 13 14 15 8 16

A: Frog muscles:  In frogs different types of muscles can be found that help the frog in performing…

Q: Study the diagram below. Put the number of the step in the diagram by its description in the list of…

A: Restriction DNA technology can be defined as a set of techniques ; in which DNA is identified DNA;…

Q: Describe in general terms the mechanism by which abscisic acidhelps minimize water loss.

A:

Q: CLASSIFICATION Domain EXAMPLES FEATURES essentially all cell-based organisms containing nuclei or…

A: The system of categorisation of different organisms into different groups on the basis of their…

Q: Consider the tradeoffs between having a living exterior with guard cells vs. a thick layer of…

A: Cuticle is a waxy, water-resistant covering on a leaf's surface that prevents water loss. It covers…

Q: In accordance to mitosis and meiosis, compare and contrast the processes in plants vs in animals.…

A:

Q: what is structural gene and what is non-structural gene? what is the differences between them?

A: Introduction Genetics is the branch of science that deals with genetic material like genome, genes,…

Q: DNA Sequence Enter DNA sequence below Original sequence ATGCCAGGCGGCGAGAGCTTGCTAATTGGCTTATAG…

A: DNA  contains the genetic information about the characteristics features of te organism present in…

Q: how should we prepare for the next pandemic? What  project that can be implemented to avoid future…

A: Introduction Pandemic:- A pandemic is the worldwide spread of a new disease, It is a disease…

Q: A survey was conducted for a certain trait (the ability to roll tongue or inability to roll the…

A: Introduction Hardy-Weinberg equilibrium:- It states that the genetic variation in a population will…

Q: Which of these molecules has multiple partial charges and thus is most soluble in water? H H HHHH…

A: Most soluble in water.

Q: Is this type of ETi sweets harmful? Wale "up wafer with COCoa cream

A: Is the sweets like water with cocoa cream harmful?

Q: Fetuses whose cells are triploid, that is, contain three full sets of chromosomes, develop to term…

A: INTRODUCTION The DNA molecule is packed into thread-like structures called chromosomes in the…

Q: "Consider the arrangement of the following four normal chromosomes from some hypothetical organ…

A: Mutation is defined as any change in the DNA sequence of any organism. It can result due to error in…

Q: In a few short sentences, describe the most widely accepted hypothesis concerning the evolution of…

A: Humans are different from other animals in many characteristics such as walking on two feet…

Q: Question - Summarize the goals of conservation biology .

A: Conservation biology- It is an applied science based on ecological principles. it focuses on…

Q: QUESTION 4 In fruit flies, white eyes (we) and miniature wings (mw) are encoded by two mutant…

A: The test cross is given in this question. The crossing occurs between the unknown parent with…

Oogenesis

The formation of the ovum (mature female gamete) from undifferentiated germ cells is called oogenesis. This process takes place in the ovaries (female gonads). Oogenesis consists of three stages known as the multiplication phase, growth phase, and maturation phase. 

Cell Division

Cell division involves the formation of new daughter cells from the parent cells. It is a part of the cell cycle that takes place in both prokaryotic and eukaryotic organisms. Cell division is required for three main reasons: