How would one best define the chromosomal location of a GENE? Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a located on a single chromosome located oWa pair of homologous chromosomes

How would one best define the chromosomal location of a GENE? Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a located on a single chromosome located oWa pair of homologous chromosomes

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter11: Meiosis: The Cellular Basis Of Sexual Reproduction

Section: Chapter Questions

Problem 12TYK: Discuss Concepts One of the human chromosome pairs carries a gene that influences eye color. In an...

See similar textbooks

Related questions

Q: In fruit flies, white eyes are X-linked recessive mutation. If a female who is a carrier of the…

A: Alleles are the alternative forms of a gene that are located on the same locus of a homologous…

Q: you could determine if two genes are located close together on a chromosome.

A: Gene mapping is the process of identifying the locations of genes on the chromosomes. The closer…

Q: Karyotype analysis shows that the banding pattern for chromosome 1 is the reverse of the normal…

A: Introduction : A Chromosome Is A Lengthy DNA Molecule That Contains Part Or All Of An Organism's…

Q: Chromosomes that carry the same genes are referred to as what

A: Chromosomes are made up of DNA. These chromosomes are the packed form of all the DNA of the cell…

Q: The region of a chromosome that encodes a single protein is called a _________, each of which can…

A: Genes are present in the chromosomes they are segments of (DNA or RNA) Deoxy ribo or ribonucleic…

Q: Which of the following does not apply to banding patterns in chromosomes O a. are unique O b. are…

A: Chromosomes are structures that contain DNA molecules and are located inside the nucleus. A single…

Q: A chromosome with a centromere located at its terminal end is termed

A: Centromere is a central constriction of a chromosome.

Q: . All the genes on one chromosome are said to form aa. chromosomal group.b. recombination group.c.…

A: All the genes on one chromosome are linked together on a continuous DNA (deoxyribonucleic acid)…

Q: Genes are arranged in a chromosome: Select one: O a. Irregularly O b. Orderly O c. Linearly O d. In…

A: Gene can be defined as a functional unit of heredity or inheritance .These are the small segments of…

Q: The normal sequence of genes along a hypothetical chromosome is ABC-DEFGH, where letters represent…

A: In the question, we are given with a hypothetical chromosome ABC-DEFGH. Here, the alphabets are…

Q: What is a haplotype?a. A species with one set of chromosomesb. A cell with one set of chromosomesc.…

A: Chromosomes are filamentous bodies present in the nucleus. They are composed of DNA(…

Q: The Q and W genes are on located on different chromosomes. Consider the image above derived from a…

A: Chromosomes are thread-like structures found inside the nucleus of cells. Each chromosome is made up…

Q: A chromosome territory is a region along a chromosome where many genes are clustered. along a…

A: Chromosomes are well-defined, thread-like and organized units found in the nucleus of a cell and…

Q: Give examples of convetional stains used for karyotyping and describe each briefly. Include which…

A: Since there are multiple questions for this particular post, I would answer the first one for you.…

Q: What causes monosomy and trisomy disorders? deletion insertion translocation O non-disjunction

A: Monosomy and trisomy- Monosomy = It is the type of aneuploidy when only one chromosome of a pair is…

Q: . In the list of four terms below, which term is the second mostinclusive?a. Genome c. Chromosomeb.…

A: Sir Gregor Mendel was a priest and a teacher who did the famous hybridization experiment on garden…

Q: Which of the following describes the pattern of sex chromosomes in this athlete? (Look at picture)…

A: Klinefelter syndrome is characterized by the presence of one extra X chromosome in a male. Many…

Q: An organism is described as Rr, with red coloring. Rr is the organism’s________ , while red color is…

A: Sir Gregor Mendel was a priest and a teacher who did the famous hybridization experiment on garden…

Q: The image shows the karyotype of someone suffering from Patau syndrome. 2 3 4 5 6 7 8 10 11 12 13 14…

A: Answer b- chromosome set 13. In This karyotype there is an extra copy of chromosome 13.

Q: Tabulate the different classifications of Human chromosomes. Group them as well using "Vogel and…

A: Humans have 46 chromosomes arranged in 23 pairs, among which 22 pairs are autosomes while the 23rd…

Q: Sex linkage refers to genes which are linked to each other on the sex (X or Z) chromosomes.

A: The chromosomes that are present in the diploid cells of the sexually reproducing animals are…

Q: Different versions of the same gene are: alleles O loci O sequences characters

A: The genes are responsible for the specific characteristics of an organism. The gene produce its…

Q: The karyotype consists of the number and structure of the chromosomes.How do changes in the…

A: A karyotype is the complete set of chromosomes of an individual which helps in identifying…

Q: Which of the following events or processes can result in Patau syndrome, Turner Syndrome, or…

A: The gene is the basic unit of heredity. Most of the organisms have Deoxyribonucleic acid (DNA) as…

Q: The number of Chromosomes in the human gene is ___.

A: The chromosomes are thread-like structures that carry genetic information. They are made up of DNA…

Q: What is an imprinted gene? Explain 2 sentenc

A: In genomic imprinting, the ability of a gene to be expressed depends upon the sex of the parent who…

Q: What is the difference between Genetic Distance and Physical Distance? Use pictorial and tabular…

A: The chromosomal theory of inheritance is based on the fact that genes are located on the chromosomes…

Q: Genes are located in the chromosomes of cells, with each pair containing two variants called Each of…

A: Genetics is the subdomain of biology that deals with the heredity, genes, genetic variations, and…

Q: In the diagram below A and B represent XX Ж A a b b в в Recombinants A A a a b b Select an answer…

A: Introduction The exchange of genetic material between two homologous chromosomes' non-sister…

Q: The Hemoglobin gene has two very common alleles: HbS and HbA. Bob’s professor asks him to draw the…

A: Since we only answer 1 question in case of multiple question, we’ll answer the first question as the…

Q: A dicentric chromosome is produced when crossing over takes place in an individual heterozygous for…

A: The thread-like structure that transfers from one generation to another present in the nucleus of…

Q: Nullisomy is a genome mutation where a pair of homologous chromosomes that would normally be present…

A: Chromosomes are long thread-like structures that carry coded genetic information in the form of DNA.…

Q: Which letter denotes the homologous chromosomes? Group of answer choices C A D b

A: Gene is the sequence of nucleotides that encode a particular protein.

Q: Make up a sentence including the words chromosome,genes, and genome

Q: In one sentence, explain how the terms “gene,” “locus,” and “chromosome” are related.

A: Introduction Genes are the main regulatory sequence of nucleotides found in the nucleus which…

Q: if a cat has 38 chromosomes, how many chromosomes are in the following cells? a) hair b) claw c)…

A: Chromosome number usually refers to number of chromosomes present in diploid set i.e 2n. All the…

Q: Find the correct order of the genes on the chromosome

A: In the given test cross progeny data table, first two highest frequency classes are the parental…

Q: humans cell nuclues contain 46 chromosomes or blanks pairs

A: Human cells consist of multiple membrane-bound organelles. The human cell consists of different…

Q: What is a genetically identical copy of an organism? a.Karyotype b.Clone c.Autosome d.Diploid

A: A gene is present in different forms that are expressed in a phenotype; allele is a one of the…

Q: Use the attached FISH image to provide a FULL description of ALL the chromosome mutations…

A: Fluorescence in situ hybridization ( FISH) is a molecular tool to easily label and detect the…

Q: During a practical, a group of biology students are tasked to study the cell cycle of an insect.…

A: This insect has the karyotype 2n=6, with genotype Aa Bb Ee HH. The students must draw a G2 cell…

Q: A pair of homologous chromosomes - 1 - 2 - 3

A: DNA (deoxyribonucleic acid) is the genetic material in all living organisms. DNA is composed of…

Q: DNA fingerprinting does not study the whole chromosome. Explain.

A: DNA fingerprinting: a. It is a forensic test to identify and evaluate genetic information. b. The…

Q: Genes contain the instructions for assembling chromosomes proteins nucleosomes traits

A: Each DNA sequence contains instructions to make a protein and is known as a gene. The size of a gene…

Q: Chromosomes in pair 23 are considered what type of chromosome

A: Karyotype is the pictorial representation of the chromosome pairs of an individual. It is a…

Q: What process does the following picture represent? XX-88-XX O segregation mitosis O random…

A: What process does the following picture represent? segregation mitosis random assortment crossing…

Q: Which of the following does not apply to banding patterns in chromosomes O a. are unique O b. are…

A: After staining with a dye, chromosomal banding is defined as alternating bright and dark patches all…

Q: Fruit flies have four chromosomes. Below, genes found on chromosome 1 are displayed in terms of…

A: Introduction One gene/allele can affect the inheritance pattern of other gene present nearby on the…

Concept explainers

Viral Replication

The virus is acellular and considered non-living outside the host cell. The replication of the virus occurs only inside the living cells. Only a few genes are present in the smallest virus, whereas many genes are present in the largest virus. These genes encode specific viral proteins.

Question

23
How would one best define the chromosomal location of a GENE?
Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer.
a
located on a single chromosome
located oWa pair of homologous chromosomes
located on multiple chromosomes
d.
located on a pair of non-homologous chromosomes

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps with 1 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

8. Using recombinant DNA techniques (which willbe described in Chapter 9), it is possible to take theDNA of a gene from any source and place it on achromosome in the nucleus of a yeast cell. Whenyou take the DNA for a human gene and put it into ayeast cell chromosome, the altered yeast cell canmake the human protein. But when you remove theDNA for a gene normally present on yeast mitochondrial chromosomes and put it on a yeast chromosome inthe nucleus, the yeast cell cannot synthesize the correctprotein, even though the gene comes from the sameorganism. Explain. What would you need to do to ensurethat such a yeast cell could make the correct protein?
1. Draw a chromosome and a pair of homologs (or homolog pairs, or homologous chromosomes). Label on the chromosome and homologous pair; the centromere and sister chromatids. In each of these drawings explain how many and where are the Watson and Crick double strand DNA molecules.
Why would an individual with a mutation that prevented the formation of recombination nodules be considered less fit than other members of its species?
Which of the following codes describes position 12 on the long arm of chromosome 13? 13p12 13q12 12p13 12q13
If you had a chance to get your genome sequenced, what are some questions you might be able to have answered about yourself?
Discuss Concepts One of the human chromosome pairs carries a gene that influences eye color. In an individual human, one chromosome of this pair has an allele of this gene that contributes to the formation of blue eyes. The other chromosome of the pair has an allele that contributes to brown eye color (other genes also influence eye color in humans). After meiosis in the cells of this individual, what fraction of the nuclei will carry the allele that contributes to blue eyes? To brown eyes?
9. Common red clover, Trifolium pratense, is a diploidwith 14 chromosomes per somatic cell. What wouldbe the somatic chromosome number of: . a triploid variant of this species?
4. A previously undiscovered single celled organism was found living at a great depth on the ocean floor. Its nucleus contains only a single, linear chromosome consisting of 7x 106 nucleotide pairs of DNA coalesced with three types of histone-like proteins. The analysis of individual nucleosomes revealed that each unit contained one copy of each protein and that the short linker DNA had no protein bound to it If the entire chromosome consists of nucleosomes (discounting any linker DNA), how many are there and how many total proteins are needed to form them?
Question:- When mapping sequence reads to a reference chromosome, discuss the parameters that determine whether a read maps to a specific chromosomal location ?
2. Null mutations are valuable genetic resources becausethey allow a researcher to determine what happens to anorganism in the complete absence of a particular protein. However, it is often not a trivial matter to determinewhether a mutation represents the null state of the gene.a. Geneticists sometimes use the following test forthe nullness of an allele in a diploid organism: If theabnormal phenotype seen in a homozygote for theallele is identical to that seen in a heterozygote(where one chromosome carries the allele in question and the homologous chromosome is known tobe completely deleted for the gene) then the alleleis null. What is the underlying rationale for thistest? What limitations might there be in interpreting such a result?
Which chromosome does this gene CAGATTGTGAAGAGGTCTCTTGA, appear on in the human genome? Answerin numerical digits only.
I. In humans, chromosome 16 sometimes has a heavilystained area in the long arm near the centromere. Thisfeature can be seen through the microscope but has noeffect on the phenotype of the person carrying it.When such a “blob” exists on a particular copy ofchromosome 16, it is a constant feature of that chromosome and is inherited.A couple conceived a child, but the fetus hadmultiple abnormalities and was miscarried. When thechromosomes of the fetus were studied, it was discovered that it had three copies of chromosome 16 (it wastrisomic for chromosome 16), and that two of thethree chromosome 16s had large blobs. Bothchromosome 16 homologs in the mother lacked blobs,but the father was heterozygous for blobs. Which parent experienced nondisjunction, and in which meioticdivision did it occur?