Human diploid cells have Multiple Choice etook Reterences 23 chromosomes 1 pair of autosomes 23 pairs of chromosomes 46 pairs of chromosomes 2 pairs of sex chromosomes
Q: what practical importance are air-borne microorganisms to the laboratory workers? What precautions...
A: Air is the carrier of many microbes. These microbes that are suspended in air particles are called b...
Q: Which of the following would occur? Select all that apply This mutant M-phase cyclin B will not be d...
A:
Q: Researchers were working to determine the evolutionary history of modern horses using fossils of fou...
A: Introduction: Fossils are the traces of ancient life that have been preserved by natural processes, ...
Q: QUESTION 5 What event would most directly lead to the development of female external genitalia? Abse...
A: Event directly related to development of female external genitalia.
Q: At birth, ovaries contain all the that person will make in their lifetime O Eggs Secondary oocytes P...
A: Females gametes are known as eggs. Female babies are born with all the egg cells that would last for...
Q: Nitrate plays a role in both catabolic and anabolic reactions in microbes. Present one example of ea...
A: Catabolic reactions are those reactions in which there is breaking down of substance Anabolic react...
Q: g processes produce/s daughter cells that are genetically identical to the original parent cell? (a
A: Answer:
Q: At which stage in the cell cycle or mitosis are chromosomes replicated?
A: cell cycle is the series of events that takes place in a cell as it grows and divides.
Q: Coronavirus
A: coronaviruses are a large family of viruses that cause illness ranging from the common cold to more...
Q: Attempt to seamlessly integrate the quotation into the text by using a signal phrase or structuring ...
A: Introduction:Nutrients are food-derived molecules that provide us with energy, allowing us to heal a...
Q: Black body Black body wild wild Black body Black body wild Brown eyes wild Brown eyes wild Brown eye...
A: Linkage map or chromosomal map is the linear graphical representation of the sequence and relative d...
Q: Why are endospore vials used to test autoclave function? A. they change color when killed B. they...
A: The whole Earth is full of a lot of organisms. Unicellular and multicellular organisms inhabit the E...
Q: The force responsible for stagnation of blood in the lower body tissues is electrical. * O TRUE O Fa...
A: Answer 1- false reason : stagnation of blood in lower body tissue is physical and mechanical. Sta...
Q: Which is not a component of Health Related Fitness? O a. Cardiorespiratory Fitness O b.Musculoskelet...
A: Introduction: Health is a state of complete physical, mental and social well-being and not merely th...
Q: In DNA replication, the cell needs to have a complete set of genetic materials, so the parental cell...
A: DNA replication is a process to form replica of chromosomes. this is done because cell division by m...
Q: Non-disjunction of chromosome 21 during meiosis one followed by fertilization can result in all of t...
A: An zygote with nondisjunction has 3 duplicates of chromosome 21 rather than the usual two. A pair of...
Q: Plant breeders use colchicine to A) prevents cytokinesis in somatic cells B) increase the occurrence...
A: Colchicine is a chemical that is used by plant breeders to induce polyploidy in plants. Polyploidy i...
Q: QUESTION 2 The best definition of ectopic pregnancy is: O Pregnancy in which fertilization occurs in...
A: In case of normal pregnancy, the implantation of fertilized egg can be observed in the uterus, which...
Q: How many molecules of ATP are typically made by ETC 2 in photosynthesis? Question 10 options: ...
A: Electron transport chain (ETC) Aids in the transfer of electrons from PS 2 to PS 1. It performs oxi...
Q: atelets platelet plug formation hemophilia megakaryocytes coagulation thromboxane A2 serotonin agula...
A: Hematopoietic cells or megakaryocytes, are essential for the generation of blood platelets. The clas...
Q: RNA are short-lived A) True B) False
A: Introduction: RNA is a single-stranded molecule in many of its biological roles and consists of a mu...
Q: Throughout history, spices have been used as preservatives and to cover up the smell or taste of foo...
A: Cayenne pepper, often known as capsicum, is a spice that dates back about 6000 years. The native tri...
Q: Section two. Match horizontal gene transfer mechanism with best definition. Answers are used more th...
A: Horizontal gene transfer is the transfer of genetic material between two organisms via non-sexual la...
Q: Is this pedigree autosomal dominant, autosomal recessive, or X-linked recressive? Can you please lab...
A: Autosomal dominant and Autosomal recessive: The word autosomal refers to the "autosomes" which means...
Q: Species Embryo (A-F) Describe the Anatomical Changes from Early to Late Stages Human F Chicken Rabbi...
A: * Embryology is study of development of an organism from embryo to adult. * As we seen above evoluti...
Q: DNA, linguistic, and archaeological evidence all suggest that the first people to migrate to the Ame...
A: There are shreds of evidence (DNA and archaeological) in support of the belief that the first people...
Q: Choose the correct statement regarding Climate change Climate change is not a real phenomenon and we...
A: Climate change is the long-term change in the temperature, weather patterns and that mainly leads to...
Q: You are studying Protein X which plays a role in promoting the G1/S phase transition in eukaryotic c...
A: The G1 phase of the cell cycle is that phase that occurs after the cell division and just before the...
Q: Methyl groups added to cytosine bases on DNA... Increase transcription of the methylated genes. Decr...
A: Transcription is the process in which the DNA contained in the body of an individual is converted in...
Q: Attempt to seamlessly integrate the quotation into the text by using a signal phrase or structuring ...
A: Introduction: Obesity is a disorder in which excessive body fat has accumulated that increases the o...
Q: What is the clinical defciency presented by hemophilic people? What is the genetic cause of that def...
A: Hemophilia is a type of common hereditary coagulation blood disorder. It comes under bleeding disord...
Q: Assume that humans are the second-level carnivores and that each energy unit in their level represen...
A: There are 7 question in total, according to our guideline i will gave you 3 answer. If you want to a...
Q: which factor most directly limits the variety of herbivores living in an area
A: Herbivores are the organism that are mainly dependent on the green leafy plant material for their di...
Q: What type of symmetry can be observed in the given image? Select the correct response: Radial Spheri...
A: Radial symmetry occurs when any plane passing through the centre divides the body into two equal hal...
Q: Please match the type of glomerulonephritis in Column A with their anatomical/morphological changes ...
A: Glomerulonephritis is an inflammation of the nephron's glomerulus. This causes acute kidney inflamma...
Q: In the image, the tight junction proteins link cells together creating a barrier. These barrier prot...
A: Cell junctions: these junctions are responsible for adhesion between cells as well as restrictive mo...
Q: QUESTION 1 Match each structure with its function * Epididymis A. Structures that make seminal fluid...
A: Introduction: The main reproductive organs of the male body are the testes, which produce sperm and ...
Q: What traits of maize have been useful for humans?
A: Animal feed is commonly made from maize. Cornmeal, grits, starch, flour, tortillas, snacks, and morn...
Q: Cholesterol in the membranes fit between saturated (single bonded) lipids so they don't get too stic...
A: Cholesterol works by immobilising the membrane's outer layer, limiting fluidity. It reduces the perm...
Q: All of the following is true of Neanderthals EXCEPT Group of answer choices A: they had stocky power...
A: Neanderthals are closest extinct human relative. Neanderthals had strong muscular bodies and wide sh...
Q: In growing E.coli, why is that (reasons) they do not grow after doubling time under 20 degrees celsi...
A: In a core typical range of its growth temperatures (20 to 37°C), Escherichia coli cells will grow ev...
Q: Which human cell is haploid? O A mature neuron in the brain O A mature muscle cell in the heart A ma...
A: The term ploidy is associated with the number of chromosomes sets that can be found in a particular ...
Q: 85 84 83 B6 88 B9 B10 B12 B13 B14 B15
A: Since the guildlines permit me to answer first three questions i will do so to the best of my knowle...
Q: What kind of results can we get from measuring O2 and CO2 production of spinach leaves in the light ...
A: Photosynthesis has both light and dark reactions Light reactions are called so because they happen ...
Q: What is microchondria??
A: Mitochondria are specialized structures found only in animal, plant, and fungal cells. They act as b...
Q: The tryptophan operon is a repressible operon that is A. transcribed only when glucose is present...
A: The tryptophan operon is a repressible operon that is - B. not transcribed whenever tryptophan is pl...
Q: analyze the muscles acting and rising/standing phase of the squat. Please also identify if these mus...
A: During squatting, our muscles work in two different phases: 1. concentric phase where the muscles s...
Q: A family that exhibits Fragile X syndrome is shown in the pedigree. In the pedigree, squares represe...
A: Introduction: Fragile X syndrome has triplet repeats at the fragile site. It involves learning disab...
Q: What is chromatin made of? O DNA only O Carbohydrate only O Protein only O DNA and carbohydrate O DN...
A: Nucleus is basically considered as main controller of the cell. Each Nucleus inside the cell compri...
Q: 8. Assume that black fur is dominant to white fur for cats. When a black cat of an unknown genotype ...
A: Suppose that the fur color in cats is controlled by: A= dominant allele responsible for black fur a=...
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Which chromosome does this gene CAGATTGTGAAGAGGTCTCTTGA, appear on in the human genome? Answerin numerical digits only.Picture name - Tradescantia spathacea meiotic cell. HPO (400x)Shown below are photomicrographs of Rhoeo tradescantia cells undergoing meiosis. Answer the following question for each of the photomicrographs: Identify the cytogenetic abnormality observed (ex. ring, chain, laggard, bridge). Identify the meiotic stage in which these aberrations are observed (as shown in the photomicrograph). Explain how these aberrations are formed and relate to the possible causal mutation(s). Will this result to sterile and/or fertile gametes? Explain.17. Which 2 cells would be more genetically similar to each other? a. two gametes produced by the same person b. two somatic cells produced by the same person c. two eggs produced by the same woman d. two sperm produced by the same man 18. If a diploid organism has a genome consisting of 22 chromosomes, its gametes will have _____ chromosomes. a. 44 b. 11 c. 22 d. 88 e. 19 19. When does DNA replication occur during meiosis?a. interphase I b. prophase I c. interphase II d. prophase II e. interphase I and II 20. The term 'synapsis' is associated with which process? a. crossing over b. independent assortment c. mitosis d. anaphase e. fertilization
- For each of the terms in the left column, choose thebest matching phrase in the right column.a. reciprocal translocation 1. lacking one or morechromosomes or having oneor more extra chromosomesb. gynandromorph 2. movement of short DNAelementsc. pericentric 3. having more than two completesets of chromosomesd. paracentric 4. exact exchange of parts of twononhomologous chromosomese. euploids 5. excluding the centromeref. polyploidy 6. including the centromereg. transposition 7. having complete sets ofchromosomesh. aneuploids 8. mosaic combination of maleand female tissuePlease help Place the images of the cell division in the right order and label them a)  What is the final product of this type of cell division? Indicate the number of dauahter cells, the TYPE OF CELLS (somatic cells? sex cells? other?), where in the body this process takes place, whether they are genetically diverse pridentical, haploid or diploid, the chromosome number in human cells, whether they contain sinale- or double-stranded chromosomes, and what the "fate" of these cells is i.e. what will they go on to do, if given the chance)?Given the following metaphase chromosomes, please complete the table. Thank you
- I need help with a biology question, please see the image below, thanks Answer the following from the image with letters A,B,C, or D For an organism with a diploid number of 6, how are the chromosomes arranged during metaphase I of meiosis? Which sketch shows the arrangement of chromosomes that you would expect to see in metaphase of mitosis for a cell with a diploid chromosome number of 6? For an organism with a diploid number of 6, how are the chromosomes arranged during metaphase 2 of meiosis?27. Which of the following is not part of meiosis-1 A Prophase-1 B. pro metaphase C. metaphase-I D. anaphase-1 E telophase-I F. all given choices are part of itFigure 7.2 If a mutation occurs so that a fungus is no longer able to produce a minus mating type, will it still be able to reproduce? Figure 7.2 (a) In animals, sexually reproducing adults form haploid gametes from diploid germ cells. (b) Fungi, such as black bread mold (Rhizopus nigricans), have haploid-dominant life cycles. (c) Plants have a life cycle that alternates between a multicellular haploid organism and a multicellular diploid organism. (credit c fern: modification of work by Cory Zanker; credit c gametophyte: modification of work by Vlmastra/Wikimedia Commons)
- A colleague e-mails you saying that she has identified an interesting chromosome variation at 21q13. In discussing this discovery with a friend who is not a cytogeneticist, explain how you would describe this location, defining each term in the chromosome address 21q13.I have a doubt, I'm not sure if the chromosomes are a boy or a girl? Or if the chromosomes have any defect and what defect does it have?Answer the following Multiple choice. 1.If there are 80 chromatin threads during the interphase stage, how many chromosomes will be in metaphase II a. 40 b. 80 c. 160 d. 0 2.A diplod cell with 30 chromosomes undergoes meiotic cell division. How many centromeres is present in anaphase I? * a. 15 b. 30 c. 60 d. 0 3.A diplod cell with 30 chromosomes undergoes meiotic cell division. How many chromatids is present in each cell in anaphase II? * a. 15 b. 30 c. 60 d. 0 4. A diplod cell with 30 chromosomes undergoes meiotic cell division. How many chromatids is present in anaphase I? * a. 15 b. 30 c. 60 d. 0 5.In a test cross, a homozygous recessive parent (mm) and a heterozygous parent (Mm) are crossed. What is the phenotypic probability of the offspring? * a. 100% Mm b. 100% mm c. 50% Mm and 50% mm d. 75% Mm and 25% mm e. None of the choices