product of this type of cell division? Indicate the number of dauahter cells, the TYPE OF CELLS (somatic cells? sex cells? other?), where in the body this process takes place, whether they are genetically diverse pridentical, haploid or diploid, the chromosome number in human cells, whether they contain sinale- or double-stranded chromosomes, and what the "fate" of these cells is i.e. what will they go on to do, if given the chance)?

Q: What is the purpose of a dichotomous key?

A: Evolution is the process through which an organism evolves over time. These changes can happen by…

Q: Question 41 The model describes the cell membrane as an assortment of integral proteins suspended…

A: Introduction:- The cell membrane, also known as the plasma membrane, is a thin membrane that…

Q: Problem #2 In sheep, white wool (W) is dominant over black wool (w). What genotype and phenotype…

A: Genotype refers to the set of genes present in an organism. Phenotype refers to the physical…

Q: There are three main subsystems to a flow cytometer. Describe the primary function of each one in a…

A: Flow cytometry is basically an bioinstrumental technique which is implicated to detect and quantify…

Q: Does Alaska have more native birds or reptiles . Explain

A: Alaska  Numerous and diverse species are located in Alaska. It is a vital habitat for many organisms…

Q: . What is the pattern of inheritance for the first generation? 5. What is the pattern of inheritance…

A: An individual's phenotype is termed that they are typically described and has been referring in the…

Q: A diploid cell has 6 chromosomes.  How many chromosomes are present in this cell in Metaphase of…

A: Introduction There are two types of cell division are found in our body,  i.e. mitosis and meiosis.…

Q: 5. Enumerate preventive measures for these infections. COMMON ETIOLOGIC MODES OF DIAGNOSTIC…

A: The table is filled providing sufficient information as follows:

Q: State the functions and importance of each of the following cell membrane components. 1.…

A: Fluid mosaic model of plasma membrane was given by Singer and Nicolsan. It explains the lipid…

Q: Draw a picture of a cell with 6 chromosomes in Metaphase of Mitosis, Metaphase I of Meiosis, and…

A: Metaphase is the second stage of cell division in which the chromosomes arrange themselves in an…

Q: PART B Re-watch the video and explain why the following steps are necessary: Why use tweezers to put…

A: Please note as per the site regulations, external links are not watched. Hence, part A cannot be…

Q: Lipoproteins in blood plasma are the mode of transport for cholesterol through the bloodstream and…

A: Fluid mosaic model of plasma membrane was given by Singer and Nicolsan. It explains the lipid…

Q: Explain why DNA replication is slightly slower in the lagging strand of DNA than in the leading…

A: DNA replication is slightly slower in the lagging strand of DNA than in the leading strand, the…

Q: In te Water Level Control Experiment, what type of sensor was used and why?  Kindly explain…

A: Experiment with water level control: the program replicates changes in water level in a tank. It…

Q: Question 34 Which characteristic is shared by a cell membrane and a chylomicron? Both contain…

A: Introduction:- All lipid molecules in cell membranes are amphipathic (or amphiphilic), meaning they…

Q: The amount DNA per cell in a mouse was measured in cells found at various stages of meiosis. The…

A: The indirect process of cell division in which the chromosomes of parent cells divide once but…

Q: Suppose a genome-wide association study (GWAS) investigation found a particular single nucleotide…

A: A sort of genetic difference within humans can be called single nucleotide polymorphisms or SNPs.…

Q: please answer question b also. b. For the Covid-19 pandemic), give any issues, benefits, or…

A: Within the twentieth century, the world suffered pandemics. The pandemics, as horrifying and lethal…

Q: 1. How may recombinant DNA molecules be introduced into human cells? a. by splicing the needed…

A: As per the guidelines, we are supposed to answer only one question. Kindly repost the other question…

Q: Consider the following image that shows the membrane potential in a neuron when it is transmitting…

A: In a resting nerve fibre that is not conducting any impulse, the axoplasm is contains high as conc.…

Q: In general, protein detection methods are based on:   a. fluorescence b. column affinity c.…

A: Protein It is one of the biomolecule which is made up of amino acids. In a protein, amino acid…

Q: Given this DNA strand: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ Identify the following: mRNA:…

A: The process by which DNA is copied to RNA is called transcription, and that by which RNA is used to…

Q: Which of the following lipoproteins is primarily involved in the transport of cholesterol from the…

A: Lipoproteins are complicated molecules that have a central core holding cholesterol esters and…

Q: 6.Explain how you should look into a microscope that has two oculars.  7. What two parts of the…

A: 6.Answer----

Q: Choose one of the three experiments performed by (1) Griffith, (2) Avery, McLeod, McCarty, (3)…

A: Introduction:- During the mid-nineteenth century, scientists began looking for genetic material.…

Q: Give five (5) other examples of samples that are best prepared using Smear Preparation Technique…

A: Smear preparations involve spreading cells from a culture in a thin film over a small region of a…

Q: Describe the molting pattern of nematodes. Which stage is usually infective to the definitive host?

A: The first question is answered as per the guidelines. Please put different questions separately.

Q: 14. Which of the following best explains the morphological species concept? a. Sexual reproduction…

A: The phylogenetic tree is a hypothesis because they reflect the best model, or explanation, of…

Q: The Ames Test... a. is always used to detect cancer-causing virus b. has the potential to completely…

A: Ames test: A test to determine the mutagenic activity of chemicals by observing whether they cause…

Q: What is a dominant trait? Recessive trait? 2. Differentiate monohybrid cross from dihybrid cross. 3.…

A: Mendel is knows as the father of genetics. Genetics is the study of genes and heredity.   Disclaimer…

Q: What is the shorthand notation for a fatty acid that contain 20 carbon atoms and double bonds at…

A: Fatty acids are composed of fat in both our body and our meals. The body breaks down lipids into…

Q: Q7. Why are Okazaki fragments formed in DNA replication?

A: The first question is answered as per the guidelines. Please put a separate question for the other…

Q: Which of these methods will allow visualization of protein localization in a cell? a. Flow Cytometry…

A: Protein localization is the technique which allows the visualization of a protein inside the cell.…

Q: Assuming that no new mutation was present in their daughter, offer a genetic explanation for her…

A: Haemophilia is an X linked recessive disorder. In such cases, males (XY) With one copy of defected…

Q: Relate the anatomic feature(s) of the four functional zones of the neuron with their function

A: ANSWER;-

Q: Lac operon experiment,

A: In bacteria, the operon is the coordinated unit of genetic expression and is the functioning unit of…

Q: A patient is experiencing increased blood pressure. How would this effect the entering the…

A: The kidneys are bean-shaped excretory organs and it is the main organs of the urinary system as it…

Q: Explain in details the collagen synthesis process.

A: NOTE- Please note that as per our company's honor code we are not allowed to cite external…

Q: Which of the following are TRUE for RNA compared to DNA? Please select ALL correct answer options.…

A: Deoxyribonucleic acid(DNA) Polymer of deoxyribonucleotides. Usually double stranded. Have double…

Q: 1. Penicillin is hydrolyzed and thereby rendered inactive penicillinase, an enzyme present in some…

A:

Q: Which of the following is not an example of constitutively expressed gene? a. genes for cell…

A: Constitutive genes are those genes which are not regulated by other genes. These genes expressed…

Q: Describe the type and strength of the relationship between number of chicks and predators. positive,…

A: Correlation coefficients are numerical measurement that determines the strength of a relationship…

Q: Functional and Ecological analysis (Assuming mermaids are real) -Discuss what environment it will…

A: Environmental science provides knowledge on the consequences of deteriorating and destroying natural…

Q: In a newly discovered species of Giant Pacific Octopus, long tentacles (L) are dominant to short…

A: As per the question , there are three traits in Giant Pacific Octopus . I ) Length of tentacles :-…

Q: What is Biology

A: Introduction:- Any system of knowledge concerned with the physical world and its phenomena that…

Q: The partial sequence of one strand of a double-stranded DNA molecule is…

A: Restriction endonucleases  are the enzymes used in genetic engineering or DNA cloning in which…

Q: When a very strong stimulus initiates an action potential, the response is: I. a longer-duration…

A: Anything that causes an animal or a section of an animal to respond in a way is referred to as a…

Q: "What property of membranes allows interactions to take place within the membrane, including the…

A: A biologic barrier which divides the interior of a cell from its exterior environment is called as…

Q: Examine closely the dissected 5 different flowers for these characteristics based on:        -…

A: Characteristics of given specimens :-

Q: Scientists were able to develop transgenic bacteria that can be used for mercury remediation.  This…

A: 1. The answer is C. DNA polymerase Plasmid- circular DNA in bacteria. The genes to be introduced are…