If a tRNA has an anticodon sequence 5'-CAU-3', What would be an amino acid carried by that tRNA? Phe, Val, His, or Met?

Q: A TRNA molecule with the anticodon UGC would be carrying the amino acid: Second base of codon…

A: tRNA brings its amino acid to the mRNA in a specific order. This specific order can be determined by…

Q: List anticodon sequences on the tRNA’s carrying the amino acids: Ala, Phe, Leu, Tyr

A: In the process of translation, the mRNA-carrying codons are coded into the anticodons, which help to…

Q: How will you best describe tRNA, support your answer with a proper diagram?

A: Ribonucleic acid (RNA) is a polymeric molecule essential in various biological roles in coding,…

Q: One of the codons in mRNA that specifies the amino acid phenylalanine is UUC. What is the anticodon…

A: Answer: Introduction: An anticodon means the three-base arrangement, paired with a specific amino…

Q: How is each tRNA charged with the correct amino acid? What are the consequences of a tRNA carrying…

A: Transfer ribonucleic acid (tRNA) is a kind of RNA molecule that unravels a courier RNA (mRNA)…

Q: The covalent attachment of an amino acid to a tRNA is an endergonic reaction. In other words, it…

A: Introduction  In the protein translation process, the key role is played by the tRNA which…

Q: Describe what two reaction steps are required for the formation of an aminoacyl-tRNA?

A: Transfer RNA, often known as tRNA, is a tiny RNA molecule that is essential for the production of…

Q: CAUCGGAAUAGAUCGCUAGUGGCAGGCAUAAUGAUCACCGGUCUGAGAAAAGUGGUACAUAUCAAC-5

A: Genetic codes are read in the form of triplets.first we will convert them to the triplets and then…

Q: A tRNA has an anticodon sequence 3′–GGU–5′. What amino acid does it carry?

A: tRNA is a RNA molecule which decodes the sequence of mRNA and convert it into amino acids to form a…

Q: Describe the anticodon of a single tRNA that could recognize the codons 5′–AAC–3′ and 5′–AAU–3′.…

A: Ribonucleic acid (RNA) is a nucleic acid found in both the nucleus and cytoplasm. It can be genetic…

Q: Name the enzyme responsible for binding of aminoacid to trna?

A: Ribonucleic acid (RNA) is a biomolecule that plays important role in coding, decoding, and…

Q: If a tRNA has an anticodon with the sequence 5′-CAG-3′, which amino acid does it carry? a. Aspartic…

A: An anticodon is the nitrogen base triplet present in the transfer RNA molecule and the codon is the…

Q: An anticodon has the sequence GCG. What amino acid does this tRNA carry? What would be the effect of…

A: Anticodon is a sequence of three nucleotides on a tRNA molecule that bind to a specific…

Q: How and when does formylmethionine become attached to the initiator tRNA in bacteria?

A: Bacterial cell is composed of three types of RNA: first type is mRNA, which codes for amino acid to…

Q: . What is wobble base-pairing? According to Wobble's rule, one tRNA is sufficient to decode the…

A: Base pair is defined as two complementary nitrogenous that are connected by hydrogen bonds. Base…

Q: Describe the structural features that all tRNA molecules have in common.

A: Introduction  tRNA is also referred as Transfer RNA which has a 3D structure like clover leaf. It…

Q: The wobble rules for tRNA-mRNA pairing are shown. If we assume that the tRNAs do not containmodified…

A: The pairing of tRNA anticodon with mRNA codon lead from the 5’ end of codon. The first 2 position…

Q: In an amino acyl-tRNA, the amino acid is attached to the tRNA through a(n) acid and the CCA sequence…

A: The translation is the process by which proteins are synthesized from mRNA through a sequence of…

Q: Which amino acid would be attached to a tRNA that read "GGU"? Val (M) Ala (A) Ser (S) 3'- Arg (R) A…

A: Amino acids are the structural unit of proteins, that is made up of carbon, hydrogen, Oxygen and…

Q: Which of the following statements is true regarding the formylmethionine that serves as the first…

A: Introduction Protein synthesis:- The process by which amino acids are linearly arranged into…

Q: The following triplets constitute anticodons found on a series of tRNAs. Name the amino acid carried…

A: Transfer RNA (ribonucleic acid) is a single-stranded RNA molecule that is used in the translation.…

Q: Each tRNA has unique identity elements recognized by its specific enzyme involved in charging it…

A: Transfer RNA (abbreviated tRNA and formerly referred to as sRNA, for soluble RNA is an adaptor…

Q: From this overall anticodon sequence in tRNA,…

A: Biological macromolecules are those large molecules that are necessary for the survival and growth…

Q: Although aminoacyl-tRNA synthetases make few errors, occasionally an error does occur. How can these…

A: Each aminoacyl-tRNA synthetase is highly specific for a given amino acid. It will incorporate the…

Q: What naturally found amino acyl tRNA synthetase can be used to attach 2-aminobutyric acid to a tRNA?…

A: Higher living beings vary in their ability to synthesize the 20 common amino acids. Most bacteria…

Q: Which of the following is the initiator tRNA for all bacterial proteins? O Formyl-cysteinyl-TRNAACG)…

A: Question - Which of the following is the initiator tRNA for all bacterial proteins?…

Q: What features are common to all tRNA molecules?

A: An RNA molecule called transfer ribonucleic acid (tRNA) aids in translating a messenger RNA (mRNA)…

Q: Give the anti-codon of this Trna?

A: Transfer RNA or tRNA is an adapter molecule, which plays an essential role in decoding the sequence…

Q: A TRNA molecule with the anticodon GCU would be carrying the amino acid: Secend ha f cod Three-er…

A: Ribonucleic acid (RNA) comprises a Ribose sugar along with a phosphate group and nitrogenous bases.…

Q: If a TRNA anticodon was GUG, which amino acid would the tRNA carry? Below is a partial genetic code…

A: TRANSLATION It is the process of formation of a polypeptide chain by joining of various amino acids.…

Q: What amino acid would a tRNA with anticodon CUA carry? Enter the 3 letter code only [A]. [e.g. Met…

A: tRNA stands for the transfer RNA and it has L- shaped structure . Transfer RNA acts as an adopter…

Q: If the mRNA produced had the sequence ACGCGU, What would be the tRNA anticodon sequence?

A: mRNA is a messenger RNA that is synthesized from the DNA by the process called transcription. The…

Q: What two different things bind to the two different ends of a tRNA molecule?

A:

Q: The 3 sites that bind tRNAs on a ribosome are on the A, P and E sites. How many sites can tRNA(s) be…

A: Translation is the formation of protein from mRNA. It occurs in cytoplasm of cell.

Q: The tertiary structure of a tRNA is shown below. Using the various colored areas (i.e., red, yellow,…

A: Translation refers to the process of polymerisation of amino acid to form a polypeptide.the order…

Q: Identify and define the two essential structural areas of a tRNA molecule

A: Transfer RNAs are coded by a number of genes, and are usually short molecules, between…

Q: Label the following regions on this tRNA molecule, stating the function of each:

A: This is a tRNA molecule. It has an amino acid arm where the corresponding amino acids bind. It has…

Q: What features of tRNA structure are involved in recognition and amino acylation by an aaRS?

A: Transfer RNA also called amino acid acceptor RNA, adaptor RNA, or soluble RNA is the RNA that…

Q: Which amino acid would you expect a tRNA to be charged with if the TRNA has the anticodon 3' CUG 5'?…

A: Amino acids are biomolecules synthesized by the process of transcription and translation and form…

Q: Is the Aminoacyl tRNA synthetases in human cells specialized or non specialized? Explain.

A: RNA is the nucleic acids similar to the DNA and contains uracil instead of the thymine. It plays…

Q: Why is tRNA called the adapter molecules?

A: Transfer RNA (tRNA) could be a form of ribonucleic acid molecule that helps decode a messenger RNA…

Q: What is the role of aminoacyl-tRNA synthetase? The ability of aminoacyl-tRNA synthetases to…

A: The soluble ribonucleic acid (tRNA) plays a significant function in protein synthesis.

Q: A tRNA's anticodon binds to the RNA sequence: 5'-CUA-3'. What is the sequence of the tRNA's…

A: RNA is Ribonucleic acid which is formed from DNA via the process of transcription . It takes place…

Q: What is the role of ATP(CTP): tRNA nucleotidyletransferase?

A: Introduction: A polymerase is an enzyme that creates lengthy polymer or nucleic acid chains. DNA…

Q: Describe the major structural features of tRNA.

A: Ribonucleic (RNA) nucleic acid, which is of three main types such as mRNA, rRNA, and tRNA and all…

Q: Which of the following is NOT a general feature of tRNA? A. All TRNAS contain 4 loops, the anticodon…

A: tRNA is transfer RNA which is an adaptor molecule and assists in formation of peptide chain during…

Q: In the tertiary structure of tRNA, where is the anticodon region relative to the attachment site for…

A: tRNA is the transfer RNA and an adapter molecule made up of RNA serving as the physical link between…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.